Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T14B1.1   

sjj_T14B1.1 RNAi JA:T14B1.1
[cgc5655]:T14B1.1
PCR_productsjj_T14B1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14B1.1 Source_evidenceePCR876WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792T14B1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX96658199666920
Overlaps_transcript T14B1.1.2 Source_evidenceePCR876WS150 Sequence/Annotation Release
T14B1.1.3 Source_evidenceePCR876WS150 Sequence/Annotation Release
T14B1.1.1 Source_evidenceePCR876WS150 Sequence/Annotation Release
WB_DNA_textsjj_T14B1.11102ttgtcagcatgaagacctgcaagttccacttctgctttttcctttgcgtcgtcaacaataacattccaaaccctttcatctgcacgattcatgagaaaatgttcaaagtcaaggttgaaaatggatgtcatttgatctgaaaattataggctccatagcaaaactcggttattgttaattttaccgaaaagagattgaacatgggtctcctcggaagctgtaagatcttgcttctcttccttgacaaacgccataaattcattacggtactttgaatccaagacaatacattgctccatgagagttctgccagatgcgtggatttcatcgtattctggatgccaaacatcatttggtgatttttccatttggaatccaggatcaacttcagacattgcaaagactaggtactcaatcatatcgtagctggtttgaacggagaatcgagttccataatcatggtaccagcaaggacgagtgttccagttcttgtggaacttgattgcttctgtttgcaacatctgtacgcgtgcctcttcatctgaaaaatggtttaattactctcattcccaaaataagctaagataaaatcctacaacaaattcgattctcaatttgttcacaagtatcaagagggccatttggtctcggggttttcagcaagtattcgatggcattttcataagactgaacgaagtactccggaataacgtgttgttgattgtcaagaggatgtgattccttaaggcggcgcgtagctctgagtactgctggatacagattgttgattctttcctggtcggcttcatgatcaaatctttcccaactgtattttgctccgaacttacgaacgttacttccattgaacatcacaactgaaaaatgtattattaaatatatgcatagtacttatttacatgattccagattcacaatgaataatcatggttatgaaatatgattgattctcaaaattcaaaatgttgaaatatacccacctgaaccagttgatgatccactacaaatgtcccaatcatcgtccgctccgttctgttcccggtttcttcgcatcgcctcagccacctgataacaatgcgctgtg