Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T14G10.5   

sjj_T14G10.5 RNAi JA:T14G10.5
Simmer:T14G10.5
PCR_productsjj_T14G10.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14G10.5 Source_evidenceePCR1095WS150 Sequence/Annotation Release
Chunk_score Abs_score1032
Max_abs_score1032T14G10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1015379110154985
Overlaps_transcript T14G10.5.1 Source_evidenceePCR1095WS150 Sequence/Annotation Release
T14G10.5.2 Source_evidenceePCR1095WS150 Sequence/Annotation Release
WB_DNA_textsjj_T14G10.51195ctccaaaaactccaaacccatcaagctacattcgattcatctacaaccgcgtaattttggagagcaccaaagttcgggccgctgcagttacagctctcgccaaatttggagcacagtgcgttgatttgcgtccatcgattcaagttcttctgaaacgctgccttttggattctgatgacgaagttcgtgatcgtgccaccttctacctcaaaatgcttactgaagcagccgaaggcctcattcacaactttattcttgacggacttcaagtttcgccatctggtctcgagcgctcaattcttgactatctccgatccggatcttactcttctccatttgatcttcgagttgttcctgttactcaacaagctctttctcaacctgaaaaacgtgttcctcaacttgtggaagaagaagagaaaccgaaagctcctaaagttgagccatatgctgcacagctggctgctattccacagtttgctgctcttggtccagtcttcaagtcatctaccagaattgctctcacggaatcaattgctgaatacactgttcatatgatcaagcatacatttgccaatgccatggttctgcaggtatttaaaaatagtgaacttttgaaatcaattatcgaatttattttcagtttgaatgcaaaaatacaatgaatgaccagcttcttcttgatgtttctgttgaattggaagatccagatggagaatgggaaactggaaatactgttcaaattgataaacttccctatggagaagttcattcagccttttcacttctagaattccctgattctggagccatctctggaagtttaggtgctattctcaagttcaaggtgatggatgtagatccaacttccggggaacctgattcggatgacacatacgagcaaacatatgtggtacgctgtagaattcttaatacatttttataattctaaattattttcagctggaagaagttgatgttaatgtgtcggattcggttcaaggagtcgcaaaatcttcatttggatctgcttgggaagcgttgggagacgatgcaacaagagaagaaacattccaattgtcaacagtggaaaatattcctgatgctgtcaagaaaatatctgaaattttgggacttgttccttgtgaacggtccgatcgtgttcctgaaggaaagacgcaacacacagtgttcc