Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T15D6.10   

sjj_T15D6.10RNAiJA:T15D6.10
PCR_productsjj_T15D6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST15D6.10 Source_evidenceePCR876WS150 Sequence/Annotation Release
Overlaps_Gene T15D6.10 Source_evidenceePCR876WS150 Sequence/Annotation Release
Chunk_score Abs_score771
Max_abs_score771T15D6.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1239404912395161
Overlaps_transcriptT15D6.10 Source_evidenceePCR876WS150 Sequence/Annotation Release
WB_DNA_textsjj_T15D6.101113cccgcatatcgtatcttgctggcatcttcgaaaattttcactatttcaattctaaaacatggaacacgaaggactactcggtggcttcaagaatgatgaaccaaagtctgcaaatcgaaattcacgataccaaattgtaatagctgttctggcgttattgctgattagcgcatggagtcaaattaacagtaagctatatcatttaatttttctttattgaaaaacgttcagactcaaaaatatcaacaaatgacgcatatggtataggagggctacttcctgattttatttccaatctgtatgctgataaacaagaggatttactttttgcctataaatcgtaagtaaaactttggactaagttttcttttgtgtaatagcaacttcagatccgattgcccctacgaggagtggaatcagctcacaactactgaactttcaagaaaaaaagaaatccatgacgaatattttagaaaaatggattttgaacattttcacccatttctctatcacaccaaaccgtcggccatgtcagcattcgcacataaggatcagatcgttgtgaccctgacttcagagaatatgatgcagtatgttaagctttcagtaactctccaacaaattttttttagtgcaacaatgtattgccgttattacgattgccgccggagggaaatcagcgttccatttaaaagtgcaatttttcacaagtcaactgtattttgtgctagacgccctaatgctaagtatattgcaatttctgcaactgcgaatgaaatccctgaatattcgattccaatagttccaagaattgagagtaagtagtgtttagttgtttaaaagtcacgaattatgtttccagagccacctcactacttcactgtttgcatggcacctctttatggggatgaagcaaagtttctgcaaatcgtagatttcattgagtaccataagcttcaaggagcaacattttttcacatttacttgagaaatgtttctgactatgatagaatgctgttagatgagtatgtcaaaacgggagacattgaaataatcaaaatgcatgatcacttttggagagctgattatatgtggcacgacgctcaaattaat