Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T15D6.5   

sjj_T15D6.5RNAiJA:T15D6.5
PCR_productsjj_T15D6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST15D6.5 Source_evidenceePCR870WS150 Sequence/Annotation Release
Overlaps_Gene T15D6.5 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score765
Max_abs_score765T15D6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1238166612382848
Overlaps_transcriptT15D6.5 Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textsjj_T15D6.51183ttcgtgaagtgggttgttgacaaaaatcgtctaaaaaattgtcatagcctggtttcctgcctacttcatacaagttaatttttttgttgatacaagctttgtatggagtttcgctttttcggcggaatagatggatatcacggttcttgatgtggttcccaagtgcaaaaagatggtaatctattgcattcaggaacgttctgcttttggaaaaatgcttgaaacgtttcgttttcattctactatgataagaaattgcacaaaacgcctaactctaaaggcgacaattattgttgttgtactgtgtgagttatattaggaatgtagaagaaaatcttcagaattttcagtttattgggttttgctccaaaatcaagaagccccaatttctgagttactcgaggaacgctgcgatcgaagtggatggaattatagttagtttttaaataacatcacttctctttttttcaatatttcaggcacaactgccggcagaacacgggattttggttcaaggttccgtgtctcatttgcggatattcaaaaatctcaaagatggctgcaccttccaaaaattaaaaatccaacgtggaatcgtgatattttaatgatagttgccagtaggccaggaagtgtttcacggaggaaagttctgaggaagacttggatgaacaaggcgaatagtaaaataatacggaatggaaggatgcaagtattgtttttagttgggatggtagctggagatcgtgatctgatgaaagccgtgaagaaggaagcagaatcatttggtgacattattgtgatgaacttagaagatacttacgataacttgccgttcaaggtaaacgattttactttttcagaatattaaacatttttcccctaaaggtgctatccctacttctttatggaacaaataaggcgtccgatttcaaaattattggaaaaatcgacgatgacgtcattttcttcccggaccgtcttaccccactgttggacgaaaacgtgattgattccagcagctatagcatctacgggtacttgtcacaagatgatgagcttgtcgttcgaaacgaaactaaaccatggtgacgtttggcttaattacaggtttttaagctagatattttttaggtatgtacctgaaactgcatataactgcacgaaatatccggtgtacgct