Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T17E9.2   

sjj_T17E9.2 RNAi JA:T17E9.2
Simmer:T17E9.2
PCR_productsjj_T17E9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T17E9.2a Source_evidenceePCR1013WS150 Sequence/Annotation Release
T17E9.2b Source_evidenceePCR1013WS150 Sequence/Annotation Release
Overlaps_Gene T17E9.2 Source_evidenceePCR1013WS150 Sequence/Annotation Release
Chunk_score Abs_score950
Max_abs_score950T17E9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII61149556116100
Overlaps_transcript T17E9.2c.2 Source_evidenceePCR1013WS150 Sequence/Annotation Release
T17E9.2b Source_evidenceePCR1013WS150 Sequence/Annotation Release
T17E9.2c.1 Source_evidenceePCR1013WS150 Sequence/Annotation Release
T17E9.2a Source_evidenceePCR1013WS150 Sequence/Annotation Release
WB_DNA_textsjj_T17E9.21146aagcggcatagatggtcttgtgggtcgtgtgtcccataacagttgatggaagagagtagaacgagacgaaatcggtaatcttaccgttttgattctgaaatacaatttttgaaacatcaaacaaataactaatctaattattcttacctctgctacatacgaatacacgacaccctttttaggaacaagggcatgagcaagttcttcctcgctattgtagactggagccaatgagtattgcttcagacttgtagtcaataacttgaaaacctgtggtacatcggtacttttcatctcgcgaaggttgcgtgtggccgtctcctcaggcaacttgtaaagcttaattgttctcgccattgtcattttggcagacaaatgcgagaagcgaacgtcgataagctttcgtggattgagcgatcggtgatagtagcggcacacggaaactggttttggaataacgattccagcagtgaaggcggcctggaagattcctgtgacgtttacacgtcgggtaatctccctgatgagcactggagccacacgtcgagaacggagattcttgtgaacgcacaggaagttgatctccaccatgttcacagtcttgtcgtacacgcggacggtttgtgggacagctccgatgaaggccaataaacggttgttgctgtcagcacgaactccacaatgccattcaggacggaatcctggcacctggagagcccacttcaggaaatcagcggagtagtcgaagcggaacatggaatcatcatcttcaacgtagttgcgggtaagaagattgtagagctcgttgagctgctcctcgtcacttaagtcaacgttggaccagcggaatccggctggaagggagaatggctccgcacggactttgtcaagagcgatgttctcttcaatagcacagttcacatcggctggtacggtttcgtctgaaaatttctacgttatcttctgttattcaataagaaatacttctgattaaactttaaaaatgactttttaaacgtacccatttgtggaactggttgagtgctccagaactggaagctcttcgatcgcgcctcatccatgtcacgtggagcagttggaatgttgggcatgttggatacatcgacaccagcaagacgaagttga