Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19B10.1   

sjj_T19B10.1RNAiJA:T19B10.1
PCR_productsjj_T19B10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19B10.1 Source_evidenceePCR852WS150 Sequence/Annotation Release
Overlaps_Gene T19B10.1 Source_evidenceePCR852WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789T19B10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1122060411221585
Overlaps_transcriptT19B10.1 Source_evidenceePCR852WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19B10.1982catccaattttcggcaatcttggaccaatagttggcaagaaaactgaaggtaagtttgtatgtgatatgaaagttacaagatttgggcatgaaacaaattgaatgaaatgtgctatgttcaattttaagatttgccatcggttttcattaactgggcggccgaacaacgagatcagggacattcagttatgagagtcatgattctgggaaaagtttacgcatggccattgaatggaaaagcagctgctgcaattattgattcaacaactgaaacaaataaaggagatgactatagattttttgatccatggcttggtggcggactacttttagagggatatggtgaacgatggaaaagtcacagaaaaatgttaactccagcatttcattttgccaagttgggtggttactttgaagttttcaataatgaatccaaggtttgaaacgattaattcaattatatatcatttcagtgattaattttcagattcttattgatcttttgagtgatttctctgcttctggagaaactgtcgatatcttcccgtatgtcaagcgttgcgctttggatatcatttctgagactgcaatgggaattaaaattgatgctcaaataaatcatgatcataagtatgtgcaagctgtagaaggatataacaaaattggagttttagtttcatttaatcctcacctgaagaatcaattcattttttgggcaactgggtataaagctcaatatgatgattatttaagtactctaaaaagtatgacggaaaaagttatcaaagaacgaagagctgctcatgattccggagaagttgaaaaggagacatccaagagaatgatgaactttttggatttaatgttgagtatggaggagtcgaatcaattaacttctgaagatattcgtcaagaagttgatacatttatgtttgctggtcacgatacaacaacatcttctacttcatgggcttgttggaat