Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19B4.7   

sjj_T19B4.7 RNAi (7)
PCR_productsjj_T19B4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19B4.7 Source_evidenceePCR993WS150 Sequence/Annotation Release
Overlaps_Gene T19B4.7 Source_evidenceePCR993WS150 Sequence/Annotation Release
Chunk_score Abs_score951
Max_abs_score951T19B4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI56822005683376
Overlaps_transcriptT19B4.7 Source_evidenceePCR993WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19B4.71177ggtaggcacagtgggaagaagattgttagagaaataaggataatttgataaatattggaaggaagataagatcgaatttaaaaataccttgtagatgatggtatctaggtgtgggtgattcaatgtcagcagcagtaagatgggcggttgctagaccatcaaccatataatcagaagctggaaataaataaaattctggataagacctagattgtgtaacacttaccaccagctctcatatgacttccagttccattaatccataaatcattaggtggacctccaagaccacctattccacctccacttccagctccggcactcgtcttttttccagactgatatccattctttcgccctccaccactagatcgtttccaacaacacattatgataagaatcagtgtaaggatcagaatcagagcaaacgcagccaaaagtatgagatacaatgggttagagtgaagaagagattgaagttgatcgactaaggaaactgtatcgccagaagccgctgatccatgcccacgtgcattgtgacgatcttttcctgatagaatagcaccgcctgatggagtgtatccaactacagaagagaatgggccatgacctgaagaatagatattaaatataaattacctaaaaataattcccaaacctttctcatttcttgcttgaatcttgaagaaataattagcttttggaagtaaattgctgacttgatgtgacaacttatcaccagctacatagttaattgtccaatctttgtccgcaagagaagctcgatccgtataaaacactaaatattcttcaatttctccatttgaatatttcggaggttgccaatgaagacttgaagagtgaggatcgccactttctgcaggcagcacagtgagatcacgtggagctgaacttggtggagccgctaatgttcgattcctggtagccattgaccaagtactcaactgcccatttgatgcaacagctctaaccgcaaactcatactcagtagctggtcgtagtccttccacagtagcccatgtctcggtgctattcacgtatctatgttgattcccatcaacagctgtactatatcgaactgtatactgtgtattgaaagcagtttcatcagattccgtccacataacacgtattgatgttgcagagattgcctcag