Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19E10.1   

sjj_T19E10.1 RNAi JA:T19E10.1
Simmer:T19E10.1
PCR_productsjj_T19E10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E10.1a Source_evidenceePCR876WS150 Sequence/Annotation Release
T19E10.1b Source_evidenceePCR900WS150 Sequence/Annotation Release
Overlaps_Gene T19E10.1 Source_evidenceePCR900WS150 Sequence/Annotation Release
Chunk_score Abs_score774
Max_abs_score774T19E10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1077960910780803
Overlaps_transcript T19E10.1a Source_evidenceePCR876WS150 Sequence/Annotation Release
T19E10.1b Source_evidenceePCR900WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19E10.11195ctctgatttctgccaaagcccagcgtggtggcaagtgtgagttgagcattactgaacgctcgtcgcattcgactctgtgactgtggtggtggcataaacgactcattgtgtgaccattcctgtaataaaagtttatatataagcattcaagttaggtgtaacactgtggacaattttaatttctccactcatgtatcaaacttcatttctcacgttttgtgtagatcgttcactgaccgtaatgttcatctgactgccgtgtccatattgtggtttcgctccgcaaagactgaaattttgattttttctaaagacttgaaacctgaaataagcctactttctaaagtatcgagttgtcatatccgaaaccatcgcatcgttgatctcattcatatctgatggatccgacgagtagaagaatctcccacaatcactcaagatcttcacatgaatatcgtcgagaaaatctcgaacctcttcatcatcattcgattcgaagactgtgtcaatgtcaccaccttgctcgtcacgatgaatcaggcaccatacaaacacatttggctttgtgcttccgttctgctgctgcaactccagacacttcgcaatctcgtcgggagcacgaattcggaatgcactacgcatcgtgttcaactgtatctggtcaatgtacctgtaggggcgacgctgtctcgaatgtaaactggcaaacgacgcgtgacgagctagacgttgcattgtattcttctcgctgcgtattttcgtgatctgaaatttcagaattattattcaaaataattatttaaagactctcttacaattagcacgtcatgaaataaaaataatttcattttcgcaaactgctgtagacctggcgacgtacttgcaatcggagaaacgaccaactctcgtatgaacattcgattggcagccaccaaaattggctgtaaaaaaattattttaacatctgttcaacaaatttccgcgcttactggaacattttcaatgtcagtgaacttgctcagatgggaaatgaagttgtcattcttttcacgagttttgttggcggttctgaaaaacaaatgaatttagaaaaataaaatttaattatgttgaaagtacacacttcaaaacttcgtcaatcgcttttgcggcctcttcagcattgttcttcagctttgaatcggatttctttgcc