Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19E7.2   

sjj_T19E7.2 RNAi JA:T19E7.2
Simmer:T19E7.2
PCR_productsjj_T19E7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E7.2a Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2b Source_evidenceePCR488WS150 Sequence/Annotation Release
Overlaps_Gene T19E7.2 Source_evidenceePCR734WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462T19E7.2
Specificity_index0.826
Rel_score1
Map_statusUnique_ePCRIV56523035653870
F16H11.2 Chunk_score Abs_score97
Specificity_index0.174
Rel_score0.21
Overlaps_transcript T19E7.2c.4 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2c.6 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2c.1 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2c.3 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2c.2 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2a Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2c.5 Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2b Source_evidenceePCR490WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19E7.21568gggtacccacttgccctatttgagcaagtgcacttttactaataagctgaatgggatcccaagagactttctagactttcagactgagcaacttacgtagtgcaatcactaaacgagtgtctctgtgagtgatatggatcgaacaacgattgagtagctgttgcagtcactgtgacgcttcctgggctcgtttgagtctgctgttgacgtcctgaagatccaatgatgagaggagacagtggagtctgaccagtggattgataggaatgatcatagtcaatctgtccatttgatacaactgcttgaagactgtcgttttgcattccaatgtaggcgtagttggatgttgggaacactggaaatttttataattataagaaaactgaaaggtatgggtttcaaactctcttatatcttgaaatattttaagccgcttctaggttaacaaccctctgccattccaagatatgagggagccctgaaaggaggaaatgttggaatgtctagataggatgaaagagagagagagagagagagagagataggaacctctgtcaaaagtgctcgagactcctgaataggcgtatggatgttggtgatgatggccgtgttgatccacctgttgttgattgaacatttgaaggtacatgttcagtatcttcttggattcttcttcttgttcgtcaaaagagttgacagctgctggagcggtgttggtggtgttggtggtggtagaggatgccagaagagaggaggcaaaatcagatggaagtgacattcgggtgggagtttgaatttcagtcgtttataagagagcaaataaaggaggataagctccagattgaggctccgcccaccaaactacgctttcatttcagaagttcaacaatgggcacgcctccttcattagtctctcaacttttgtcaggaaaaatgattagagcacacgaattgataagagaatagatagagatagcgaggaatagacggggagagaaaaagaggagaaagtgcaaccagcagcaactcaccatcgtttggtacaacttctgttggaagccactgttcgacagtctgtgaatcggttacattgaacaaagtctctggttgagcagtcgatgttgttggaattgttgaaatggaaacttgattgcaggaatcacgcatctcttgcatctcggtcactgaaaaataaaaaatgttgaatgaaaacacaataattaaatcaaaaccatacaatttgcctgattataaacaattccttccgacagagaaacattattgataactggatgttgttgcttattatcaaaaagttgattcaattgtccttcttctcttgaaacatcctcgaaaagctgagcaagatcttcatcaaacagatcatcttccaattcggctttttgagttggatgttcaagagttggtgtctttatttgttctcgttgttgttgctgatgtttctgctgatattgattgttattgaacgactcgaagaatccattatagaatcctttcgaaagatcttcatatcgagcattctcttcggcagtgagtggctgaaatga