Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19E7.2   

sjj_T19E7.2 RNAi JA:T19E7.2
Simmer:T19E7.2
PCR_productsjj_T19E7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E7.2a Source_evidenceePCR734WS150 Sequence/Annotation Release
T19E7.2b Source_evidenceePCR488WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript (8)
WB_DNA_textsjj_T19E7.21568gggtacccacttgccctatttgagcaagtgcacttttactaataagctgaatgggatcccaagagactttctagactttcagactgagcaacttacgtagtgcaatcactaaacgagtgtctctgtgagtgatatggatcgaacaacgattgagtagctgttgcagtcactgtgacgcttcctgggctcgtttgagtctgctgttgacgtcctgaagatccaatgatgagaggagacagtggagtctgaccagtggattgataggaatgatcatagtcaatctgtccatttgatacaactgcttgaagactgtcgttttgcattccaatgtaggcgtagttggatgttgggaacactggaaatttttataattataagaaaactgaaaggtatgggtttcaaactctcttatatcttgaaatattttaagccgcttctaggttaacaaccctctgccattccaagatatgagggagccctgaaaggaggaaatgttggaatgtctagataggatgaaagagagagagagagagagagagagataggaacctctgtcaaaagtgctcgagactcctgaataggcgtatggatgttggtgatgatggccgtgttgatccacctgttgttgattgaacatttgaaggtacatgttcagtatcttcttggattcttcttcttgttcgtcaaaagagttgacagctgctggagcggtgttggtggtgttggtggtggtagaggatgccagaagagaggaggcaaaatcagatggaagtgacattcgggtgggagtttgaatttcagtcgtttataagagagcaaataaaggaggataagctccagattgaggctccgcccaccaaactacgctttcatttcagaagttcaacaatgggcacgcctccttcattagtctctcaacttttgtcaggaaaaatgattagagcacacgaattgataagagaatagatagagatagcgaggaatagacggggagagaaaaagaggagaaagtgcaaccagcagcaactcaccatcgtttggtacaacttctgttggaagccactgttcgacagtctgtgaatcggttacattgaacaaagtctctggttgagcagtcgatgttgttggaattgttgaaatggaaacttgattgcaggaatcacgcatctcttgcatctcggtcactgaaaaataaaaaatgttgaatgaaaacacaataattaaatcaaaaccatacaatttgcctgattataaacaattccttccgacagagaaacattattgataactggatgttgttgcttattatcaaaaagttgattcaattgtccttcttctcttgaaacatcctcgaaaagctgagcaagatcttcatcaaacagatcatcttccaattcggctttttgagttggatgttcaagagttggtgtctttatttgttctcgttgttgttgctgatgtttctgctgatattgattgttattgaacgactcgaagaatccattatagaatcctttcgaaagatcttcatatcgagcattctcttcggcagtgagtggctgaaatga