Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19H12.11   

sjj_T19H12.11 RNAi (4)
PCR_productsjj_T19H12.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19H12.11 Source_evidenceePCR1125WS150 Sequence/Annotation Release
Overlaps_Gene T19H12.11 Source_evidenceePCR1125WS150 Sequence/Annotation Release
Chunk_score Abs_score1062
Max_abs_score1062T19H12.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV48980294899205
Overlaps_transcriptT19H12.11 Source_evidenceePCR1125WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19H12.111177ctttattccgttttggctttcttgtttaaaattcctattcttacaaaaacaatttttgtgaatcgaaaaattaaatacagaaatccaactacaacgagtgtgaggaatgcaatgacatccagatagtaatgtgcaatccaacccaatttattgatagcgggaacttgagagcgatggtttggaaatctgaaatagtgattttttgaatttttgcgtattacaagctgctcacttactccatggcaaactctagatgtttcatcaaattcatttttggatcaatcggttgttttaggagcacatcacggagggcttctgcatttttggaaaatttcggatttgtcaccatttccctcacggtttttgtcagcttttctccattcgccaaatcaaatttgtcataagcaatagctcctccgtgtcttgcgagcatatctgcattttctggttgatctccgaagattggaacggagagagctggttttccagtgtaagcaacttccattgtacttcccagtcctccatgggtaacaaataatttcacacgtttgtcggcaagcaaagaaggctgtggaacccatttcttcaagtgaacattttttgggagtctcttctggaattccacgtcatctctttcatatttccaaataaatgtaacatctggaagtgactcgaacattttgataagtcctgctttaaaattatccggcatctcataggatcgaataactgatccaaaagatatcagtactgtagactcccgttcttgcagaattttttcatattcctccggtaattcatcagcatgtttaattttctccaagtcaattgtgatccctccaatgtgaacaatagcaggagttgttgcaacagcaaaatccagatatggattcgagttcgtaatgtaaatcggagactgactaacaagatctttccaatatggcactgaatgaccaaccgctttctcaataatattattttggtactgcccaagtcgatccatcccaatttgtccaaaaaagtcccggtagacatcattgagccgatcgaaaaagccaaagtcaggagccatcttggagccttccaaaggtatgtacccaagtgtactaggctgaccaaatgctttattgaaaactaaaaatcgcactgctgaccagatagggatacatggcacatt