Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20B12.2   

sjj_T20B12.2 RNAi JA:T20B12.2
Simmer:T20B12.2
PCR_productsjj_T20B12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T20B12.2 Source_evidenceePCR794WS150 Sequence/Annotation Release
Chunk_score Abs_score731
Max_abs_score731T20B12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73845797385681
Overlaps_transcript T20B12.2.1 Source_evidenceePCR794WS150 Sequence/Annotation Release
T20B12.2.2 Source_evidenceePCR794WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20B12.21103gcgacaaggaaaagttagcgaaatttcagatttaagcgaaattaatacgtttttttttcgaaattttaatattgtacagtttaaaaaatttatgaaaaaatctgatgaactctctgtgcacgtttattttagccgtgaccagtctttcaactttataaccttttttcagtcttaaagccgtttgtcaaaattaaagatttatattatttcaggccttcaaggttcttcaatgcaaatgcattcacatctcgccaactccaatctcaacttgaacataaatccagcttcagtcggacctgatcgtaatcctggatcagttatgcatcacaatttggacatcaatcctccatcagttgcatatcagaatttgacagttccaatgacaccacttgcatattctgtatatgatcgagatgctctgacacatcaggctccggcaagtaacatcgctgccacaatggttccagcaactccagcaagtcaattggatattccgatgccagctcttcagaacattgtctctacagtcaatttgggagttcaattggatttgaagaagattgcattgcacgcgagaaacgccgaatacaatccaaaacgtttcgcagcagtcattatgagaattcgtgaaccaagaacaactgctttaattttttcgagtggaaaaatggtgtgcactggtgcgaagtcagaagaagcaagtcgattggcagcacgaaaatatgcgagaattgttcaaaagttgggatttcaggcgaaatttaccgaatttatggtaagtgtttctggaaaaaggtcacaaaatcatttgaataatttttttgtaggttcaaaacatggttggttcttgtgatgttcgttttccgattcaacttgaaggattgtgcattactcactctcagttcagtacttacgaaccagaattgttccctggattaatttatcgtatggtcaaaccaagagttgtgctccttatttttgtgtctggaaaagtgagtttaagttatgaaataaccttttctatgttaaattttcaggttgttatcactggagcaaaaacaaagagggacattgacgaagcattcgggcagatttatccaatc