Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20B12.3   

sjj_T20B12.3 RNAi JA:T20B12.3
Simmer:T20B12.3
PCR_productsjj_T20B12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T20B12.3 Source_evidenceePCR999WS150 Sequence/Annotation Release
Chunk_score Abs_score915
Max_abs_score915T20B12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73821227383273
Overlaps_transcript T20B12.3.2 Source_evidenceePCR999WS150 Sequence/Annotation Release
T20B12.3.1 Source_evidenceePCR999WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20B12.31152aaaccttttcaggctgatttttcggatgatggctcagaagatgaagcgcctgacaatgtcgatgtcaattatgagttggagagggaagaacccaaaagcaagtctgttgcagaattcactaaatttttgcaagaatgcgaatatccggatgacatcataaaatactttaaaacgataaagtttttcgaaaaagacgcaaaaactggagatattgtttctacaaaatcactaaagtttactgtaaccggtttcattcaatacttgtttggcacgaagcgaattcagcgtccagttctcagaggaatcgctaaaatttttggaagatatgatattttccacttaatctccccggagcttgtgaagtctataacggtgagttaaaatatctgtatttgtttatacgaatcacacattttcagcacctaaaagaaactcgcaccaccgcctggttcaacctgttcaattttctttcattcgtcccgcacccaactgatcgagtgacgaaaccattatttcgccagttttgtgtcagaactccattcaacgataaaagtatgaaaaaacgaaagctgacatggatctcaactgactatgacaacgtttggatggctgttatgaatggaaaaattagtgacaagttgacactgaaacttattccatatatcactcagaacgtcatttcgaaattgaaagcaccattcaaatctgctgatttctttttcaaaatgttcgacaaaactgactatcatggaattctttcgcttggtgctatttttcgtcttatttcagaacataacttgtaagagattttatttgaaatagattcatataaatctttatttcagtgaatatccgaaattctacgacaaagtatattcattgacgaacccatctcttctctatatgagtcagaaagaatccattctgacacttctggatagtttcctgtcgtctacgtgagttgcaatattctagaaaatttattctgaatcataccttttcagccatctcccaacatacatcactgcttcgttcctcaaacgactctcccgatgccttcttcttgctccaattgatgctcaggaaccaattcttggattaattagaaatcttgtgattagacatccaaactgttctgaattggttcatcgt