Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20F5.3   

sjj_T20F5.3RNAiJA:T20F5.3
PCR_productsjj_T20F5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20F5.3 Source_evidenceePCR708WS150 Sequence/Annotation Release
Overlaps_Gene T20F5.3 Source_evidenceePCR708WS150 Sequence/Annotation Release
Chunk_score Abs_score625
Max_abs_score625T20F5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39096873910530
Overlaps_transcriptT20F5.3 Source_evidenceePCR708WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20F5.3844attaaacgacttgtttcagcagctgtttgcggcgttcttcgatgagtagacctcctctttgttcagcagcgtgcttcatattcaatagtgcttcccgtgttttcttggcttcatctggtctcgtggaaaactcattcgacgacttcttatcacttttggaatagatttcgttgatcgcctttttgtattcattgagaattcgtcccttcgcatcagatgccattttctctcttctttctttactcatcggcggcacattcacatacaaaacagctccctcctgttgtggagttacattaagagttgatttctgaaataaacaaaggaaaatatgaaaaggacggcaagatggtacctgaatcgccaattttgctgctttaattgcagatggattatcctggaagttgatcataatcataagtggagattttaatgtgactctggcaatcatggacagtggcttatcctttccattttcaagcttgaccatgacatcttcatattgccgaatatctacctggaaataattattttactttgatcaattcttttaaaaaactaactttaagagaaaaatgtcttgtgagctcttcgacaagtaatccttcaactctttgaatttcttttattgtttcctggacgactgcgttttcctccaaattcgagaaaactgctggtggattctgaaatataacttttaatataaatctaaatgacttattccaacctttttcttattgtccgcttttttcttagcatttacaactgcagaagtaaagatttgagcttgtttttgaaggaattgagctcgagaggcaccttgggctaatcgaattactgctaa