Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20F5.6   

sjj_T20F5.6 RNAi JA:T20F5.6
PF:GL1_6H10
PCR_productsjj_T20F5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T20F5.6 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Chunk_score Abs_score1069
Max_abs_score1069T20F5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39206863921758
Overlaps_transcript T20F5.6.1 Source_evidenceePCR1069WS150 Sequence/Annotation Release
T20F5.6.2 Source_evidenceePCR1069WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20F5.61073taacctccttccaccacaggattctgctccacatcttctacaggtggttgagcaccgccgcgagctcttctgtcttgcgccttctgaatccattcaagctctaaagctctcaagtcacgaagatatggttgaacttgcaatggctgcaagtttttgaagtttggagcatctggattggcgtctggattgagtagtgcaggcatctcaatgtttttcggtgcacgctgtccatttgcattcgcttcggcttctgcctcgttgcgaaccattcccatgattcgattgacaagttctgctatctcagctctatctgcaacttcttgctcgattccttgaattggtgggagcggattgagaggttcttggacaactacatcatgccatggagcatcctgagctggatcgtctcttgctcgaagatttccttcaagttcttgaagcctggcacccaactgattcaatctttgttgtgcattatccaaatcacgtctcatatcaatttgatccaattcaaaaggatttcttgcgtacggaccttcgagattccaaatataatctcgtaaaccgtcaatagcctgttgaatcgcatcgttcctgtgcaatcccggattctgagcaatggcacggaaaatgtggtgacgaaccattcgaagatctcgaacattgtttccattacgattggcacggcgaggagcagccaactgcgctcgagcagcaattcgatgtcttcgatacatacgatcagcaatattcagtggagccccagcagcaccagctaaacgaagatccgcagcaggcccaagaaaatcaccagcaccatctacagcatcatcaccaccaccagcagcgggagcatcgccagctggagcagcagcagcaatctgaacatcaatagcaatatcatcgtccggaagatctccaaagattcgtcgaaaatgagccgctaggccctgatcgtttggtgctaagaattcgtcgatttcattcgccaaatgtcgaactcctccaggagcatttgcatcccgtccaacaattggcaccacaaaaccaccaactgctccaagtcttcggaa