Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20F5.7   

sjj_T20F5.7 RNAi (5)
PCR_productsjj_T20F5.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20F5.7 Source_evidenceePCR745WS150 Sequence/Annotation Release
Overlaps_Gene T20F5.7 Source_evidenceePCR751WS150 Sequence/Annotation Release
Chunk_score Abs_score709
Max_abs_score709T20F5.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39265953928030
Overlaps_transcriptT20F5.7 Source_evidenceePCR751WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20F5.71436ctccaaatccattcttcggaacttcttctttctgcaccagctccatcttaagtgatccagattcctcgcttactttcagctcaaatgtcttatgaaactccagctcttcgagtttaaccggtggctttgtgcacttgatagcagattgaccagctgccatgctgttaaccttcgcaaacttttcagtcccgccacgtgtgcgaccctcatcatacacaacttgtggcatcagaactcccgtctcaatactaattccattttcagtaataaacttcataacttctgctggtgatcccgtcagtccagcaacaacaatatgagtatttccttcggaatccttacgaagatacaattcaggtccttcaagatcttttttcgatgcaacatgaatctccattcggttacttcgagccattttgagagtgagcacttgatctggttttttcggttttccacccttcgcctttttctctcgttcgaatttctccttctcggcaagatatcccatcagttggaagttcgtgttacatgattctgccaccggtcttttagtgaattgacgacacgtcggacatcgaacaacgagaaggggcctgcaaaaaaattacattaatatttaaagctgcattagagccaattttattttgaaataccgcaaaaaaattcgtaaattttgaaaaaaactaccgatgatttgggcgaattttcaatcaacttaaatttccgcgcgattgtctgtaaactccgcacatagaaccgtgccgcacgtttttcttcaatttcgacgcaaaattgttattttttgtgctgtttctataatttttaattaataaaaaggtcataaatgacttttaaaagattttccgtttttgaaaataatttcagttaaaagctttttttaaaacatgtatgacctgtttcttctttaaaaaaaaatagacaaacaacacaataaataacaatttgcgtcgaaattgaaaaagctaaagtgcggcacggttttatgggcggagtttagagcaaaaagcgcggtatttcaaatgaggagattagaaaaagttgaaaatcgccaaaatcatcgatttttcttcattttttgcgcattttaaaggaaaagcccgtatttcaaaaactaacgcattgaaatctctgagattatcagtacattcctcgcatactgtatgaccacaatggagaaccttcggcttgcgggtttttgtgtcgaactcccgaatacaaattaggcatgtgacgagatcggctgtggtgaaggcaagtttgtcggccatttagctgaaaatgttgaaaatgattattattactaattattaaattttttttaacgtttcctggagtacgcaaataaaaaataaaataaattgaaaaaaaaacaaatgttatacccatttttctggtgtagatcagggttgggacca