Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20H9.6   

sjj_T20H9.6RNAiJA:T20H9.6
PCR_productsjj_T20H9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H9.6 Source_evidenceePCR1028WS150 Sequence/Annotation Release
Overlaps_Gene T20H9.6 Source_evidenceePCR1028WS150 Sequence/Annotation Release
Chunk_score Abs_score1007
Max_abs_score1007T20H9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII22471342248277
Overlaps_transcriptT20H9.6 Source_evidenceePCR1028WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20H9.61144ggaatcaataggctccgtgagctgaatgttgatgataagatgaagcagctagaggatcgagtgacactttatagttcatttgttgaaaaaacgaagggaatggagagtgctaacatcttttctaacaaagatgaatatgaggctcaattgaaacaatttcaagaaaaagcacaaacactgaatttgcatcagctggaaagttatttttatacaaatattgatatttttatggcgtccttaaatatattggaggctacagataacgaaaaagaagctgatgaagattttagagaggtgattcgtcttataaaagaattaaaccgttcttacccagactataatccactatttgaatttgaaaaacttaataatcctcaaaatagttttccacttctatatccagtttatgagactattcaagagtattccaaaatcagtgaaacactcgagaccacgatattatctggtattcaaaagaatattgataatgttatcaaaatagccaagtcagctaaattgaatgcagaaagtgttgaacaactttccaatatgttattgtctcgacattccaaatcaactaaagcttccaaacacataactgggtttttcaatggcgattcggatatttggaatattttcgacaacttgaaaacggattggataaataaaacagtgtatggacaagcggaacacattggtaaagctttgcaaacactaaagacagttcaaaccaacgtgcaagattctaatgaatcgattagaagaggcgaaaatgatatgctgaaggaaatcaccgatgtgcattcaaaagtcattcgactagtgaagtatgctgaaaccgtggagccgtttattggaagcatcgaagcaattgatatacctcaagtgaacaaagatgtgaagatctctgagatggacataatggaatctttgctacacaacatgacattgctgtcgtccaaaatatcaacgctgaaagaattgtataaactgatgaatactttgaaaatcgaggaaaaccagaaaaagttagctgaaatggtcagaattgctagtgttactggagacaagctcaagttgtaccgaggaagtcaagaattcaaggatattcactaattgcttctaccaatgcatgacgcgtata