Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21B10.1   

sjj_T21B10.1 RNAi (2)
PCR_productsjj_T21B10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T21B10.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
T21B10.2c Source_evidenceePCR92WS150 Sequence/Annotation Release
Overlaps_Gene T21B10.1 (3)
T21B10.2 Source_evidenceePCR110WS150 Sequence/Annotation Release
Chunk_score Abs_score90
Specificity_index0.08
Rel_score0.096
Map_statusBottom50_percentile_ePCRII89295908931253
T21B10.7 (3)
Overlaps_transcript T21B10.1 Source_evidenceePCR998WS150 Sequence/Annotation Release
T21B10.2c Source_evidenceePCR110WS150 Sequence/Annotation Release
T21B10.7.2 Source_evidenceePCR45WS150 Sequence/Annotation Release
T21B10.7.1 Source_evidenceePCR138WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21B10.11664gaataccgcgtgtttttgcttgttgatttgttttccttttaaaatgaatggagtgcgatttacaaaaggtacaatatttgaaatgtattttattccagtttttatctgattttttatatttctgattaaagagaaaagaaaaagcttaaaagaaaaaatttagaactgccaaaagatgcacaggagttttccgaggcttgtccgatcgcaaggtaacttgttgaaaggaatgtttggaaaatccggggaaaaggaagcagtaaagcagctgacactggaagaacaggagagccttcgcaagacgcttcccagcatccgtgctagagaatccacacaagttactgcttcagctgattctgtcactgaatttgacgatgatctgttgacgatgagccgtatcgacacggatgccatccgggccagaggttttctcaaatacacgcaaaactatgttcccggcgttgatgtcaaaaaccaagtacttgaagcagcgtcatcatgtctaagaagtgctggagtaaagtctgaaaacgtggatcagtacaaatttgtggaaggagataactctgtaaagttcgagttgttgaacaggctgggaaaatccatcgaacattggccaaccaatggaaaacttcttcatttggaaacagtggcagacgtcgtcgaattttatcagacgcctgtcaaaaatgtaacaaaatatacagagttagtttttgtttaaagatgcttattgaattattaattaaaataaattatagaatggctcgcgatgagaacaaaccgaaaaacgtctcgattatggagcatgctgcacgtttccatcctgaagacactcacatgtatcatggtggaatcactgcattcccaggatcaggtggtgaagttctctctctgagacagaaacgtctacttcgacagttccaaccgaaaaaagaatggttcgattatgatgatcaggtaatttttaaagtttcagtgctgacttaaaatcggcatttttcagacatttgattacactcgtcctgacaagaatatgccatgggatccagaagttgctaatcaaatggacaaatacactgataaacgatacaacctaaaaacaaagcaattcactaggattcgacaataaaaaataatttggttcatttttgtattagagtttcatatttagtatttttagacctattttctttttgtttgatctatcgatttttattgttgtaaataaaattgacgttgaaaaaaatatttttgacctcttcacgttttgatcttcctctaaagttttgctctacgcaagttatttcagtttttgatttaaaatgtttgttccattcacctcggcagctcactcgctcacttcgctcattcgaggtggcgggcagccttcgaaaagcaatctgtctggacaaaggttttggttatctctttttctttattttccgccagttgatttcatgctcccgcgacttccacacgcaatctgcaaaattttggctgctgaatcagggtaatggggtctgccgtgccttttttccaaaacgttgactgatgtttacttttcttttatgtttcattttgacttgttcaatggttttgaacaatagtgtgtgcaaactaacgtttttctttaaattcaacacgcaagctttgaggtgttt