Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21B4.11   

sjj_T21B4.11RNAiJA:T21B4.11
PCR_productsjj_T21B4.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T27F6.9 Chunk_score Abs_score864
Max_abs_score864T27F6.9
Specificity_index0.294
Rel_score1
T22F3.1 Chunk_score Abs_score819
Specificity_index0.279
Rel_score0.948
C48D1.6 Chunk_score Abs_score856
Specificity_index0.291
Rel_score0.991
C50H2.9 Chunk_score Abs_score398
Specificity_index0.136
Rel_score0.461
Overlaps_pseudogene C48D1.6 Source_evidenceePCR1032WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRIV1322388313225075
T22F3.1 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Map_statusBest_ePCRV35902843591476
WB_DNA_text sjj_T21B4.11_11193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagctagacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacaaggttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcgtttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaagaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtgttccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_101193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataaaagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtaaccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_111193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgacgccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_121193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtaggtattccttgttcgaagctagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_131193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgatcctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_141193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacatgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttcaaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_151192aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgttgcgtatccgtttgcatcaataacagctgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaacgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtgttgaaaacgatccattatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_161193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtgcggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgcttccgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_171193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatagtattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgatggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_181193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcatgattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_191193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatctttgaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcatgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaaaagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_21193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaatttaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_201193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatattctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_31193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgtgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_41193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaaaatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccatattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_51193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_61193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcgtttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtgttcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttatttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct
sjj_T21B4.11_71193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccccacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcatccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttggtacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_81193aggttgcaaggaaatgacaattaaagtaccggaatatgagcaattggatttaaaaacaacataattatgcttaatactttgtcgcgtatccgtttgcatcaataacagcttgacaacgacgtggcatcgagtcgatcagcttgtgaataactgacatggggatagctttccaagcgttttccaactggttgaatttggcatctgcatttgaagcccgaatacctccaagacgtctttccaactcttcccacaaatgctctattggattcaagtccggagactgacttggccaatcgagcaaatgcacacgacgacgttgaaaccaggaacgcacatgaagagaagtatgcttaggatcgttatcctgctgaaacacgaagccacggcccacattttgaagtgcccagggtcgcattgtagtttccaagatgttttcgtattgaaaacgatccataatgctttggattctccttagtgggcccatggaagtgctggtgaagcacccctacaccatgacgctcccacctccatgcttaacggttgggcattgatactttggagagtacctagagccaacaggacgacgtacccaggaatttccatcactcccgaacaaattgaacttgctttcgtcagaccagatgtgtttagcccattcctgacgtccccaacgaagatgcgcttttgcccacgcaactcgagccatgcgatttttcttactgatgaacggtttcttgactggctttcgtccgtgtagtcctgcttgctgtaaacgtcgacgaacagttcgtttacttggtacaggttcatttggagaacttataatcatttgaatatccgtggcggtcctatgcggatcttctcttgctgatcggaggatgttgcgatccatcctatgggttgtcactcgaggcctgccgggcgagattctcaaagcgacggatttctaaacatttattattaaaaaataatatttttcgaactcacctcagtttgatacttcttgattactttccaaatagtcgacggagaacgttgaatttgcagcgcgagcattttcgtgggtattccttgttcgaagccagctacaatggctttcttgacgtccaaggaaagatttttacacccaacagattttaccataccttaaaaataatttatcaaccaaacaaatccagtgcaacaaacagagt
sjj_T21B4.11_91193actctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgtaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatgaatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaaaggacctttaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatcttggaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgttttagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgtcgtgtgcatttgctcgattggccaagtcagtctccggacttgaatccaatagagcatttgtgggaagagttggaaagacgtcttggaggtattcgggcttcaaatgcagatgccaaattcaaccagttggaaaacgcttggaaagctatccccatgtcagttattcacaagctgatcgactcgatgccacgtcgttgtcaagctgttattgatgcaaacggatacgcgacaaagtattaagcataattatgttgtttttaaatccaattgctcatattccggtactttaattgtcatttccttgcaacct