Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21E12.4   

sjj_T21E12.4 RNAi JA:T21E12.4
Simmer:T21E12.4:Screen_A
PCR_productsjj_T21E12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21E12.4 Source_evidenceePCR1195WS150 Sequence/Annotation Release
Overlaps_Gene T21E12.4 Source_evidenceePCR1195WS150 Sequence/Annotation Release
Chunk_score Abs_score1174
Max_abs_score1174T21E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI43967364397930
Overlaps_transcriptT21E12.4 Source_evidenceePCR1195WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21E12.41195aaggaaggagctcaacgacaaggactgattcttgacagtcacgatgaattgtacaaatggttcactcaacaagttatgcgaaatcttcacgttgtattcaccatgaatccatctggaagtggacttcgtgagcgtgcttcaacatcgccggccttgttcaacagatgtgttctcaattggtttggagattggagtgagaatgctctttatcaagttggatcggagctcaccagaacaatggatctcgatagaaccgattatgaaggatcagttcgtttgacaccatcttgtgagttggttccttcacagcccacatatcgtgatgcagtggtcaacacattatgccttgtgcacaagacagtacagaagttcaatgagatggagacgaagaagggacatcgcgtgatggcatgcactccacggcacttcctcgactttatcaagcaattcatgtcactgttccacgagaaacgatctgatcttgaagaggaaaagattcacttgaacatcggtttgaacaagatcagtgaaactgaagagcaagtgaaagagctacagaagagtctgaaattgaagagtaatgaactccaggagaagaaggaagcagccaacttgaagttgaaggagatgttgggtgatcaacagaaggctgaagaagagaagaagttctcggagcaattgcagaaggagctcgcagagcagctgaagcaaatggccgagaagaagacattcgtggagaatgatttggcacaagtcgagcctgctgtagcggaggctcagacagccgtgcaaggaattaagaagagccagttggttgaagttaaatctatgtcgagtccaccagtaactgtgaagctgactttggaagcaatctgtattctgcttggagaaaatgttggaaccgattggaaggcgattcgtcaagttatgatgaaagacgatttcatgacaaggatccttcaatttgatacagaattattgacacctgaaattctgaaacagatggagaaatacattcaaaatccggattgggaattcgataaggtcaatcgtgcgtctgttgcttgcggtcctatggtgaaatgggcacgtgctcagttgctctactcgacaatgcttcataaagttgaacctttgagaaatgaactgaagagattggaacaggaagctgcaaagaagacccaggaaggaaagg