Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21G5.1   

sjj_T21G5.1RNAiJA:T21G5.1
PCR_productsjj_T21G5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21G5.1 Source_evidenceePCR789WS150 Sequence/Annotation Release
Overlaps_Gene T21G5.1 Source_evidenceePCR789WS150 Sequence/Annotation Release
Chunk_score Abs_score705
Max_abs_score705T21G5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68758346876853
Overlaps_transcriptT21G5.1 Source_evidenceePCR789WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21G5.11020caacaatggacgcaaagctacgttttatgaaagaagctagaatgatgctgaagaactacaaacacaagcatattgtcatgatatttggaattgccacattgaatagtccattgttgattcttatggaattgtgtccgagtgagtatattcttgatcttttcactcattcactcttacctttttgcagatggatccttgatctcatatcttcggaaaaataagggaaaagtgactttactcgaaaaacttcgattctctgcagaagcatccagtggattggcatatctagaaaaaatggaatgtattcatcgtgatatagctgcaagaaattgtctgttgtctgcaaagaatgtaagatattttcgcggttttcgttttcattataagtatgtatggcggattttttgaaattggctacatgttgctacattaacctaaaaattcaacttctactccatctgaaatttcttattttcaggagataaagatatcagatcttggattggcggatgacaagggaatggtaattgattattcattggataaacttccaattaaatggttagctccagagattatgcaagacaaggtttattcattgaaatctgatatttgggcttttggtgagttgaagtagacattttgcggtttttctttaatcaaattaaaatattttaggaattatgatttgggagatttttgcggaaggtgatgaaccatatccaggactcaataatacacaggctcgtgccaaaatagttgttctcgactatcgaatgaaatttccggatgaagctccaactgaactagttcaagtaattgatacatgttggaaaaaggatccagatatgagacagacaatggttttacattcatctgcacttcaattactttatgagaataagcttccattattatttgctcaaacaattcaagcaacatcacttccaccgggaacaattgctcaatcatcaactccaattccaattccaatatctggtgtatctggtgctccagctg