Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21G5.2   

sjj_T21G5.2RNAiJA:T21G5.2
PCR_productsjj_T21G5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21G5.2 Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene T21G5.2 Source_evidenceePCR548WS150 Sequence/Annotation Release
Chunk_score Abs_score527
Max_abs_score527T21G5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68705806872243
Overlaps_transcriptT21G5.2 Source_evidenceePCR548WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21G5.21664cgaacaaaagtctcaaaaatgctttcaccttcatcatcatcatgatttttgagacaataccattttcaactatgacccaacaattttcaaccagtatctcaatcaattcacccttattcaaatgttcattcatatttctcattcaattcgtaatatttacgtatattcatattttttcttatctatgtgttttgttcaactattttctattcatcgatctctcaatttcaactgtgattgtttctttttcacggtttatcaaatttcaaacaaatctgcgacaactctccaattactgccgaaatgaacgatttttcaccagttttcttaaaattataatattaacatctataaatttttcaacaaactaaagattacacgaccagggctagaaaattgaatgtgtggttttttgacacggaaatcgaacatcccctcgttcctatggtaccataaattatgtaaacttgaactttcacaaaaaagtttcgaaaacatccctatatctaacttctaattaatttaaaataacacgtgtcgacttttgtttcattctgcaaaaaagtgcttcttctgccaatttcaattatttttcataaattatccttcagtatgatgtgagtttttatcttcaatctttcattatttctaagaaagtcttcttctcaatttcagagcaaatctgttgtttttcgtgctaaaatcttcatttctcattttgaatgcaacatttgtcagtgtaattcttgttggttgttcgtcgttgattaaaaagaaacgtgatccaccgtcgacaacaaaagatgaaacagtgacaacacaaaaaccgttgatccagaatagtacacatagtactgataaggtaaattcagagatcttttgttgctagtcaaaggctataccgattgcaaatttcaaaaatcagcaaaattagagagacgcgcggaattttttaagcgtatctctatacatttttgcaccactttcgaggctcgaaaaattgctccaaatgtaaattcttgcaggcttttttaaaaaagtttttagggtagttggttgcaaatctttcagtgttttttttcataaaaaatgaataaatttccaaaaatagagaatatatgacattgcattctttctcaaaagtcatattacagggttcagaaccatctgttcatccagctccaactccagttgccattcaaactgttgtaacacctaaaagtactaccgtatcaaatacgacatcaacaccatctcaacctacatcaaaacctaaaacaccggttgctggatcacatgcgaaatccccgatgttcgaaaaaactcaaaagaaaacatcaaatgagtcattgaagccaccaccaagaacacttcgaggagctgttccaataaatacaaaaagccgtgaagcccaaaaaacaatgaatgacgttgttgaagtatcggcaaaaaatgtggcaccgcctcgcaaagaaaaatcatccatgtcgcaggattttgatgactacttgaataatttgggagagaataaaaattagatttctcaaaaataaattgttttctttcattgattcaatgttgaattcattttaccgtcatatttaaacttccaattacatatcatcgttttcttagtcactgttatatccgtgttttgcaggttc