Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21H3.3   

sjj_T21H3.3 RNAi JA:T21H3.3
Simmer:T21H3.3
PCR_productsjj_T21H3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T21H3.3 Source_evidenceePCR554WS150 Sequence/Annotation Release
Chunk_score Abs_score470
Max_abs_score470T21H3.3
Specificity_index0.819
Rel_score1
Map_statusUnique_ePCRV11560061157085
Y73B3A.12 Chunk_score Abs_score103
Specificity_index0.181
Rel_score0.221
Overlaps_transcript T21H3.3.2 Source_evidenceePCR550WS150 Sequence/Annotation Release
T21H3.3.1 Source_evidenceePCR554WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21H3.31080accggtattcatcattgtttacgtcgttccgctcgctttcaaacaatttatattgattttaattaattaattaattatcctttttcatttttcagggttttctaacaacaccccctgcacagcgaaagcaagatggccgatcaactgaccgaggagcaaattgccggtacttttttaaattctgattgatggacggaggaccgggagattgaagaaatctaatcctctctcatttcgaagcgaattgagcagaaaccaagcggcgcggcgtagaaatttaaatttaatggatgaaacattagccgtagcagcagatgtatagcgccactatttttgtgtgttttattccagatgttggctggttctcgcggcgaaaaatctatcaacaattgtataaaaaactacaaaattcgagaaaaaaccaaatcaattttgccaaattttcagagttcaaggaggcattcagtttgttcgacaaggacggcgatggcacaatcaccaccaaggaattgggaactgttatgcggtctttgggacaaaatccgactgaagccgagcttcaggacatgatcaacgaagtggacgctgacggaaacggaaccatcgatttcccagagttcttgacgatgatggcccgcaagatgaaggacacggacagtgaggaggagattcgtgaggcgttccgagtaagagatttgtggaaatttataaattcatttttgattcactatagagaagcctcatgtagtatagaaaatctcattcaaatcttcctatttgcaggttttcgacaaggacggaaatggcttcatctcggccgctgaactgcgccacgtcatgaccaacttgggagagaagctaacggacgaagaggtcgacgagatgatccgtgaagccgatatcgacggagatggacaagtcaattatgagggtgagtccttacaagacctttttttttcgaaatttcatcaaatttcccatatttcagagttcgtcaccatgatgacaaccaagtaaatcacaccaatcgggatctgaagccgccgtatcgtttgcgaatcaccaacaccttttctctca