Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T21H3.3_f   

sjj_T21H3.3_fSequenceACCGGTATTCATCATTGTTTACG
PCR_productsjj_T21H3.3