Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22C1.6   

sjj_T22C1.6RNAiJA:T22C1.6
PCR_productsjj_T22C1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22C1.6 Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene T22C1.6 Source_evidenceePCR986WS150 Sequence/Annotation Release
Chunk_score Abs_score923
Max_abs_score923T22C1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79439127945477
Overlaps_transcriptT22C1.6 Source_evidenceePCR986WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22C1.61566cgtaccgaagaagccaagagcaaattggaagagttatgcagaggacttcaaaaggcgaatcatcaagtattattttctttattgcatcaataaaaattaaatttcagacccgcgaggaagcatgtgccaaaatgaagaagttggaagtggaaagaggattagctgttgagcaactgaaagtgactcttaaagatattgagaagacaatggctgaaggaagaagcaaatcggattcattagccgaagataataagaagctgagcgagaaattctctgaaattggacatcaatacgaagaaaagatgaaagtaattgatcaacagatccagaagaaggagaaatattgggaagagtatggaaagaccaaggatttggagattaagctgcttacagcaaagcttgaatctgcatcgattcaagttaagaaatcaggaatggaaaaagatgaattggcgaagattatgttggaagaaacagctcgtgttggtggagcattgaagactgaaaaagcacttcgtgagcaagttcaagagtattctgcaaaatattctgaattgacaagttgcttgtcgaaaagtaatgaagcatttgataagttcaaagatgaaatttcaagagtcaataagaagtgtatgcaagtagagaaagagggcctttcttacaaaaagaagtctgatgaggctaataagtaagtgaagagaactttttgtgaaaacatttgaagttgcaatatataagcatgattctttccatatgaaatttaaaattaatcttacttgcttagatgtgtagaaaaacctgtagtcgaaaacattttaattttggttttttctcagagatacttaagaaattgggaattcgaaaacgaaaatgatcaattttcaattttttgtgaaaaatcgaaaaatggaaaattgataatctgaaaacaaatttttgtatattttttattgttttttttcaaagttaatcaaaaaatcgagaaaaaactcaattttcttctctagattgaaacaattttttaaataaaaatgtaaagtaataaaaatggtcgaaattttgagcaatttctttgaaaaatcaaagttttttcgacatcaaaaatttatgatttttcgataattttatttaaattccatcaaaagttatctaaaataataactctttataaaaattgtctcgtatttagaagtgatgtataacatttctcgagtcatttattttcagaaaagtgcttgtgttgactatgacaaatcaagaatatgccgagaagatcgccacatcggacaagaaaattcaaatgcttgagaacctgtgtcgcgctctccgaaaaggcgaacaggagccggtgaccactgccgaaacaaccgaggcaaactgagaatatattactgttccctcattaatacgccgaattcttctggtcccggatctcgtgtatatatatatcaaactaacagtgacaaataataatactagtatacctgttttcataattttgttgttttctaaaatctcacagcttttctccaaatgttttgactgaccatttttcgtctccttcca