Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22C1.9   

sjj_T22C1.9RNAiJA:T22C1.9
PCR_productsjj_T22C1.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22C1.9 Source_evidenceePCR555WS150 Sequence/Annotation Release
Overlaps_Gene T22C1.9 Source_evidenceePCR561WS150 Sequence/Annotation Release
Chunk_score Abs_score477
Max_abs_score477T22C1.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79586127959803
Overlaps_transcriptT22C1.9 Source_evidenceePCR561WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22C1.91192atttctgccaacgaacttaaacaatcttatttacaaatctactacgacttcgaacaatcaaatttattcctgacttttcaaaagtgagagatggtaaaaccggcaaatacttcgtcttcacttatcactaaaagagttttgactctcggtaataatgtcacaattgatatatacgatcatcattattatccaatggtaagttcatttttaaaaacttctaatcttttgaaatttttcagtggttttggattgtaatttctgttggatttgtcttctgtactctgagctgtgctgtttggtttatgtgtgctatgtggagattgaaaagtaatattagaatattctaatattctgtggaacttttcctgtcaggcttttgctcagataagattttctttgctctcagaatcctagctctggtttaggtggtgctttgatattttttgcaaaagatctctaatggggttatttaagtaatgtagcaaaatgtatttaaatacatttgtgacctcacaaatgtatttaaatacacgtttttatatacttgaatacagttgtgacgtaatttttctacactttttaattttccgacactacttgaataaccccataagaaacaatcaaaatgtgtatgttggaattttagaactggatgtttttcagagggtaaagaatgtaaccatccatcgtttgaagcgcgtaccgttgtgacaaaagatggagaagagaaaccggatcccaaaatggctcaaaaatcagaaaagacttgtaaaaaattaggtgcattgggtgaagctgaatcgttggccaagagcttcaaaagtatcagatcgaaaaagtcgatgaagtctacaaaatccaagaaatctgaaaaagatgtaggacatgatgatcataagaaggaagatgttcatggtgatcaaaaggatgataataaagatcgaaacgatggaggacgagattctcatgttgttcagatggaacataattctgaagaggaacacgagccgagtggatttaaaaaggttttttttaatcgttgaattttgaaggtacctcagataaatcaaaccacgcaggcaacgcgtctagaccacgcagaagctggcagtcttgagcgtggttgtaggcgttgcctgcgtggtttggagcggcacctgagccgcttatcgtagaaaaagctttgatgagc