Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22D1.4   

sjj_T22D1.4 RNAi (5)
PCR_productsjj_T22D1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22D1.4 Source_evidenceePCR1006WS150 Sequence/Annotation Release
Overlaps_Gene T22D1.4 Source_evidenceePCR1006WS150 Sequence/Annotation Release
Chunk_score Abs_score964
Max_abs_score964T22D1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV69109346912040
Overlaps_transcriptT22D1.4 Source_evidenceePCR1006WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22D1.41107atttctgctggaatcgatggaagcaaaggaaaattgaaaatttctgaaaaaccagccgaaaaggatcttgcagtttacgaagtagacctccgaactcctgttgccaagggagccaaagttaccataagaatcaatcttcgtatcacacaagtacttgagccactcccatccaagattcagcaatctgacagtcaatttgttgttcttcacacatctgcatacgttccttccctgtacgaaactgtgacccaaaaaacaactattagaaccactcaaggaggcaagcttctatccgcaaccacagtttctccatcgaaacaagaaacggaacgtgtcatctacggaccatatgttaatatcccagcttttgagacgaaaccagtcaaagttcattatgaaaataactcgccattcgttattgccaccatcgtggaaagattcatcgaggtttctcactggggaaacatcgctgtggaggagtacattgaattggttcacaagggagctgagcttgatggtccattctcaagaatcgattaccaaatggaccgtcgtggacgtcgccaaccagcactccaacagtttaccacagttcttcctgctcaagctaaagatatctattatcgtgatgagatcggaaacatttctacatccgctgtacgaatccgtgctgacagcgttgacgttgagattcgtccacgattcccactctttggaggatggaagacgtcgtatgtcatcggatacaatttgccatcggaagagtatttgtacagcaaaggaaatcagtatgctctcaaaacaaagttgttcgatcatgtgttcaatgatattgttgtagagaaattgcgcactaaagttcttcttccagaacatgtcaagtaagttttcattttactcattgcgttagttttcaaaaaaagttattatgttggttaacatttccatttttaaatgctgaaatgattttctcttttttcaggcgtgtaaaggtggccactccatatgctgttgacagaagaccagaggagctcaagccaacatatctcgatactactggacgtcttgttcttgttctcgagaaggaaaacattgtgccagaccaca