Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T22D1.4_f   

sjj_T22D1.4_fSequenceATTTCTGCTGGAATCGATGG
PCR_productsjj_T22D1.4