Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22E5.5   

sjj_T22E5.5 RNAi (3)
PCR_productsjj_T22E5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T22E5.5 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Chunk_score Abs_score846
Max_abs_score846T22E5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX64085756409732
Overlaps_transcript T22E5.5.2 Source_evidenceePCR956WS150 Sequence/Annotation Release
T22E5.5.1 Source_evidenceePCR1035WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22E5.51158tttggttgggattgggtttattttaataaatttgataatcaaaaaattgtgaaatgaaaaaaggtaaaaaacaggaaatttattcgacaacgacctcttctccaacatttggatcctcggtgacttgttgtggctcgaagtcatcagttggaacgaagagtgggactggctcgactggtgctctggctccctcaaccttgacctgctcaacgtactttggtggctccaagtttttgcggatctgctcgagttcttcgttttgcttgcgtccccactctgctggtggtcgtccggttccgcggacgagggaagcctgcttctcctcttctgggttctcgaacaagtaccgacggtctccgtaagatcttctgtcggtttgacggtcgaacttagaagcggtggtgatctttggtggatggacagaggaagcagcctcctctgggtcaagtcccttcttgagagccttgttacgggcggcttgacgttgacgctcgtgtaactctttcatctgaagtaattgaaatttggttgaatgtcacacacaatatcaaataagtctcattgaatagtttaaacttacgtcatagtcttgacgttcacgtctcttctccaagtcgtacttctcagcctcgagcttgacgatacgagcatgaaggcctctgattctctccttcaaatcgtttggaagaagtccagagacgtcttgtacacggcagacggcggccaagaagtttctcttggcatcctccatctgttccttgctcatgacatcctttcctcccttagcctgaaagtttcttaattagtattcgatttaaaaatgatacaataaaaatacctgagccaagtttccgaattgagcagcttggtctcccttggaggcgacagtgaagttgcgtccagctccggcttcaactcttccgttgaaagctccagccatcatttgttgacgacggaccttctcctcgttcttgcggatcttctcggcatcagccttagccttgcgttcgtcttcttccttgcgacggcgctcgtcatcttgacgtctacgttcagcgaactgacgctcgtcctcttcacgctcagctcggcgcttctcttgcttctccttgagttcacgaagctcttgttcgatttgctccttctcaagaacacggc