Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22H2.3   

sjj_T22H2.3RNAiJA:T22H2.3
PCR_productsjj_T22H2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22H2.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
Overlaps_Gene T22H2.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score Abs_score747
Max_abs_score747T22H2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1169532811697579
Overlaps_transcriptT22H2.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22H2.32252tttccaattttattgcaccaatccttgcacaaaatctccgtcttacattttggccgatctccacgcttcagcggaccaattatagctccagaatattcgaaaataactagaaatatcagaaaaaatagataaatgtgtctagacatttatccgatcaataatgtgaattgaggaggagggaggtggaaagtgtaaaaaacagcgtctgctccatcatcagctgccatctgttcacaatagaaacgtgtcaatttagtgttgctttgtgttctttttctattgaaaaatgaaaaaaaaaactgtgataatgcagcaggtagaagtcagaaagttagacgctttcaagctgtcggagcagcgttcggagcatttttctgcacaaaactattagtccgcatactggcttcaatcgacgacatgtgtgactccggagccagaaatttcagtctaaaaattaagttttttttgcaaaaacttttcaattctaaaaaaaataaataaataacctgaaagttttagccaatttttctctgaaaattcgccgataaactgagttgctcagaatcattgtggagcattggcacattgaatgggaagccattagaaaggtcatgttggtggcaagttctgaaactcagagcacatttggagcattttatgagcgccgcctaccttgaagatgagtagcttcaccaatcacaatgaacaacataatatttttggggatcacaatgagcccaccgggcagagccatttgcatgctcaagctgaaaagagccgcccggtgcatgttataggtctgggaggacatgtgctggcggagacgctgtagaattatcattgtgtgaacaccaaggtacacacagtacctgaaacatttttagaggtaggtatgtaggtaggcacgagacaggcgcgagacaggtaagcaattagtagcaggtggcaaggcatgtaggcatattataggcaggtaggcaagcaaaaacagttttgtaggcgagcatcaatgcacgtagggatgttacatcgaggtttgtaggcaagcataactgaaaggcacgaaggcaggctggcagacaaacggataatttgtggaatggcatataggaagttacataggcaggtttacaagcggcagtcaaatgggtaggcaaaacaggttcggaggtatacagaaactgcaggcaagtaggtaggcacgaggcaggcgcataatcaagtaggcaggaaagcttgagacaatcagctatgtaggtatgctggtaggcatacatatgataggtacgtgagcaggggaaagcttctgggacggcattaggcagactttaaaaggaatattggcgagctggcaaaaggcggataggcaggcctgtaggcaagcaggtaaacaatgtctacctatcatgacagcctcaaaactcaccaaacaatgaaaaacacccaaatcaaagctccgatccctgtcacaaacatccatggattctggtgtggatcgtaggcttcaaacccgtcaaaagccatccaaaacagacattgtgggtagttctgaaaatttgaagctcagcagaaaattaatgttccactgttgcctactttcttcacaaaatcatatttttgctggtaggtcagactcgagttccacatggaaattgcggtgaaaaatgggaaaatgtgagttatgaataacagaagcttgttgaaatgcatcttgctcgactggttctgcaatgattttcagataaaactcgggcttatagtcttgaaaacttgattaatctggacagctgcattgtggcgatatacgaagcatgtgagcccggcggagagctcgaaacaaaaaatcccaacccaaatggacatactcatatggggacttatgaattgtccaaaaaattctccagtattgtatccaccgaccattggaaagaaatagaaggctgggcaaacccaggacatgtagatttctgttacgaaggatgcggtctggaattttaaattttttgaagtcgggtcccaccacgaaaactaccgtacccttttttttattttccaacctatacaacatggatgttaatttcaagctttttgcgttaaagtttaatttaaaaaaaaactggatgccataattttagttactgtacaaaaatagggtcttactaggaaagcaactgttcctgtttgcggtgagacccgtaaattattaaactcgaaaggtttttgacatggtgtcaaatcaaagcacatgattc