Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22H2.5   

sjj_T22H2.5RNAiJA:T22H2.5
PCR_productsjj_T22H2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22H2.5b Source_evidenceePCR886WS150 Sequence/Annotation Release
Overlaps_Gene T22H2.5 Source_evidenceePCR1225WS150 Sequence/Annotation Release
Chunk_score Abs_score1078
Max_abs_score1078T22H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1168859411690807
Overlaps_transcript T22H2.5a.2 Source_evidenceePCR868WS150 Sequence/Annotation Release
T22H2.5b Source_evidenceePCR1109WS150 Sequence/Annotation Release
T22H2.5a.1 Source_evidenceePCR1225WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22H2.52214tgagcaaaaatacacatttcgtgaattttacactttaaataatcaatatatgtagtaaactatttgaattatcgatttttcaaaaacaatttatttttgatatataattttgtgagaaaaaagtgggtgggacagacactgaaaactagaagaaatgggcggggcttggagacctgagagtgggcggggcttaacaaggaaatgtgggcggagtctgaaggaaagtgacgtcatacatatattggaagaatgcgttggaataataagaaaaacgtttttaaaaaagttggcttttaacaattacagtcacaattgcaatcacaaccatcggggcagcagcatgcggagcttgctgtacctttaagaagaactgtaataggctcctggaattaaaaaaaggtcaattgacaaaaaaccgggattgcataccaaattatgctctaatcaccgaaaaacacagcaaaaatgtaaagcaaatggtagagggttaagcagacggacggttagactgaaaaagcaaaaaaaaattgataattcaagcgaaaatccataattatcccaaaaatcaataatttggacgaaaattcatattttagggaagacaccaatcctttttcaatattcgataattttcacataaatcaatagttttttttagacaaaagttgataatttaagcaaaaatcaataatttccacaacaaaaaaacttctgttagcaaaaagcgataatcacaaacctccgttattgcggttttggctctgttgctcaaactccatgaaatcctgaaaaattagcaaagttacagtaattctacagcaaccaaacttacaatcaaaaacgtggctcctatcagtactcctttgagtttgacgtccaggtcgccggggactgaaaattgcaagaattattgattgtatggacgggggcgacttacagttgacggcgaacgtgtcggcgtcggtgaacgcctctcggaagcaacctccccattttttggtgatcgcgccgacaactgtgccgttgttggcggttttgatctgaaaattttgagggtattgaagcagcggacattttagggggataggatcttcagccggtagctcactggcttcccgacagacccgcaaagtgtcggctgctcggcaaccgctgtttcttgggttattcgacaaagccgctaggtgtcggctgcacagcacaagtcagcaaagcaggtggttcaagcagccgacactttacgggtggccagtaatcctagtaaattgcggccgacgcctcactggcaaaacctcagataaagggccggtgaaaattttgggattttcaatacattcacagcctcaggtaatatttagcggccgacatttcacagcaccttgcaatcagacaagctagcatgtaccttgcagccgacacctctcaggaccctagaacttcacctaccggaaactccttatcctgacatccgcaaagcatgcaacagcatggaccatcaatctggaagatcacatttccatctccatccataatatcataattcgacgacatgcatccacaccgctgacggatgatacccagaacacccatcgatggggtctcgatgatacattcctgctggcagcatccgatgcatgccaagcatccacagcaaccacctccgcaacacttgaactcacgcttgatggtcagaacttcctggaaaatttgaaatttcagagcatgtggatcaattttggcttggtaggcctgaaaatttgggctcaggattgctccgcgagcttgttgaaccagatgctccgtgagcttaccctcttaaagttatccacaatatgcatgacgaatccacgttgcggtccacagcactgtctctcacagcatccggactcctcgaacgcgtagtaacactgttctccatttgcattcttgagcacgtacttgttcttggtctcccagtccgtcacaatctcgatgagctccttgatttgatgcaccatgattgtatccaagtaggtaagatactccaggcctgtaggcacaccttggattgctggtggcattggcatccacacggagccaggagccggctgcacaaagacacctggctgagttgtgattgcttgttggtgctgctgctgatgcatttcgaattgttgcactggattcataccctgtgggttgtagcccggttgttggtttattactggttgctgc