Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23B12.7   

sjj_T23B12.7 RNAi JA:T23B12.7
Simmer:T23B12.7
PF:GL1_2C11
PCR_productsjj_T23B12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23B12.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene T23B12.7 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848T23B12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV84635128464619
Overlaps_transcriptT23B12.7 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23B12.71108aaacgaaatgaggttgtcgggtgagggattgtggagcgtcgtgacacactttcttcacgtctgcgtctcttaatatcggcaatcttttgtgtttaatgagtcgcaaatgggaaaaccgaggtttatgttcaatagaaaaatacattggaacttacacgaaaaaccaatcgaaaagtgtttgaagataaatataaataagctaagttttatttttataattatataaaaataaacaaaaacatgaaaatattagaatccacccataatttgtgcttcgagatcgtccaaagacatgtgctccaaattgttggcacccgtattagttgattttactggctcatccgaagctttcttcacagtttccaccggtggttgtaaccattcacacgtaatttcaggcatcggagcattcccagtttcaagttcagctccccatgcatttgctcccgactcaaattcgaggattcgtttccgtcgatcttttttctctattgccgaagatatgtgagatatgattccaaaagtcgaaaataattttcgaatatcgtcttcagaatagtctaatccttctgatgttttccatttcaaaagtaatcgaggagttaatttttcttgacttttctgatgcttttccctttctgttttcatcaatgttgccttctgtttcacctcttcgttgacttctttctccaactgcctccgaattgcttcaatttcttctttaaagtttctttgatcggttttcttctttttagcttgttgtgctgctgtcattggagttgatccatctgctgaccgttttccaccattggaaaactccttttctcttttttctaaatcttcaattaactttttcctttttccatctgcttcagccattcgtttactatggtgttcctgagccattcgaattctctcttctcgattatcatattcttcctgaaaaataaagtattacattgaccagcgacagtaaaaacgtactcgtttctctttatcatataaaaaatcgaatgcttctttggcttcaatgaatctacgttcggcttcttctttattatccaaatttttgtccggatgccatttaagacactgtgcacgatatgcc