Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23B3.6   

sjj_T23B3.6RNAiJA:T23B3.6
PCR_productsjj_T23B3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23B3.6 Source_evidenceePCR730WS150 Sequence/Annotation Release
Overlaps_Gene T23B3.6 Source_evidenceePCR730WS150 Sequence/Annotation Release
Chunk_score Abs_score648
Max_abs_score648T23B3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67068306707790
Overlaps_transcriptT23B3.6 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23B3.6961cggatgtctttgccttcattgaactttttcttgtgttggtgatggtttcccgagtgaagatatcctgagctgttccagaatgtgatactgatgaagacgatttctcgttgaaaatgagttttttgttacaactgagaagagccaatggaatagcaacctgtggagcacatgagacaatttcatcaattcggctgaaaaaggtactgaatgtttcgctgttgacggcaaacaccatgataaggtgaacgacgagggagagctgaaaatattttattgaattctaaaaatggatcttcgcgtagtcaactgtttcaattttcaattgtataatacaaaataagcacatttcacaaaactgctaaatatttcaaattgcgtaccgtatatgtgactaaaatgagcattccaatcttcaaagtctttctctcagctctatcaataagtgattttgttttgtcacttgtaaccaactgccttttgtcacggagattgttatatgctactacatagaacacaattgacaacagtggcaatgcatagacggcaattgtgaatggctgaaaatttaattgatgttcaaacccttaagattttattttttacctcagcagtgctagtcgccatcatttgaattgtgtttgtggcagcatcataatgagtatagactccacatagtttctgatagagaatagacaaaacaagtgagagaattgcaacgaaagtcaatgttccacgaacaatccagcatccccatgcatttattacttttcctggatagacaagaaccatcattcggttgagtccagcatagaagagccaaatggaagaggcaatgcaggtgaacatattaatgatcaaaatgtcctggatgtaccagcaactgtcgaaatcatcagactggaaatgaggcaaaatatttcggggatttatggaaaattttcaactgaacgttgccgacttt