Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D5.11   

sjj_T23D5.11RNAiJA:T23D5.11
PCR_productsjj_T23D5.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D5.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
Overlaps_Gene T23D5.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
Chunk_score Abs_score825
Max_abs_score825T23D5.11
Specificity_index0.621
Rel_score1
Map_statusUnique_ePCRV1575804315759192
F57A10.1 Chunk_score Abs_score319
Specificity_index0.24
Rel_score0.387
T23D5.8 Chunk_score Abs_score185
Specificity_index0.139
Rel_score0.224
Overlaps_transcriptT23D5.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D5.111150gcagttcctgcacacctacaatgcgagtttgatctactttagtttctcccgcccattgggtctttcaaatttcacaatggaatggatgatgggaatctacacaggactatactctgcaacaatttgccagctggcaattcaattcatttatcggtactgggcactttttgatactccgaagatcaaatatttccatggatggtactacttgatttgggtgtcctattactcattcttcggagtcctatgggcatttgcagttgggcatttctttgcgatggatgacttcggaagagaataccttggtggggagatacttcttcgttacgagaggaacatcacagatatccctgtgcttggcctgattgcctatgaaggtaatagcatccgctggaggaatgtctatgggctctctctaatgacattgatctccacaatacagtactccatcatattgatttgtgggcaaattatgtacgaaggaatgcgtattaaactatcccttctttctgctcagagtcgacgtcttcataagcaatttttcagggctctcgtgattcaggttcgtcggtttttgctctgtcagaaaaccagtatacgtgttacagatcactgcgccaacaatcattctgttctgtccagtcttcttcatgatctacgccccatttgcagacttggaaattagtttcccatcgtgtataatccagagtggcttcacagtgtatccagctattgattcgatcatcatgatgagctgtgtttctgagtatggaagggcgctgaaaagtaagaactgtaacctgattgtgataaagttgaaaggttctaactttcttacagaagtgtataggaatgcgaagaaattttgtgctgtgaaaattccgaaagacgtcagcaaagatgttgttggagcaaacgtcattactacaaagctttgaagaagtgatttattgtctatggttatgtgaacatttctgatctttttacgggtttacttacatcaataaactaattgaggcaattataccgtgattcgagcgggtgtgcgttctaaataatagagtgcgcaaaatgtgatataccccggacctctatcgatatcggttgctaaaataccattagctcaaaccaccaacttcctgctctcgaa