Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D5.2   

sjj_T23D5.2RNAiJA:T23D5.2
PCR_productsjj_T23D5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D5.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
Overlaps_Gene T23D5.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
Chunk_score Abs_score635
Max_abs_score635T23D5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1573351215734624
Overlaps_transcriptT23D5.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D5.21113atcatgaaagcaatcgtctcaattggagggtagagactaaatactgcgtagataaatccggtttgaaacgtgaagctgacattgaagaacggggtgaataggactggaagagccggaaggtggaagaggagggtgggaagagttatcttaaaatttgtattttgctttagattttcaggccgtatcgaaaaattctacctgtacaactaaagccttgaagaattgttgctgcaagtttccattgctcactgagaagtttgccatttccttcttcattttcttctgcatctgaaccccgcaatagataatcacggcgtactggaaaccgagaattatcatggatccgaacaaaaatatcaaattaaaccatcgcatggttccatcagcattctgtaattgtttgcataatctctggtgagtctagcctacaacttacataagcgataacaatgaagcgggccgtttcattgatctccaaattatagactccgtagagctcttttctgaaaaaaaaatgaatgaaaaacacgagatgtgactcaattacttcatataatcatcggaatatggctctgcttgagcgcaaaaatgggtcatgaaaccgaaagtcacgccaaaagacgacggatagaggatccagataaggaagttccatccagtgaacgaggagattaaggttcgacggctgaaaaaacggtactctaactttgccgaactctgtcaaactctgtcgaactttttgtcgcacgctgtcaagtttctgtcgcatactgtcacctttttatcgcacacatccaacttttgtccaaggccgttaatgttctgttgaacactataatcgcttgtctaactctgtcaaactctgtcaaactttgtcgaactttgtcgaactctcacaccgccaattaaaacttacttcatcaagatggcatatctgaagacaaactgaacggcgagcatgcacatgatgcttgcataggctcctgaataggcttcaataaagaatctgagcagtttctgtgaggctccaagatagtcattcagactaaaataaataaatcctgaattgaaactgtgcaaatatggatgagccagtacttcgagacaagaaaa