Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D8.5   

sjj_T23D8.5 RNAi JA:T23D8.5
Simmer:T23D8.5:Screen_A
Simmer:T23D8.5:Screen_B
PCR_productsjj_T23D8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score270
Max_abs_score270T23D8.5
Specificity_index0.816
Rel_score1
Map_statusUnique_ePCRI99876069988805
T10C6.14 Chunk_score Abs_score61
Specificity_index0.184
Rel_score0.226
Overlaps_transcriptT23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D8.51200atgcaacttaattttcagacccaatgacctcttcggacaggacaaatcccgaaaaagcagttcaaagcccccacaaaagttgaaaaagctgatgtgaaggatgaaggaaccacctttaaattggcactaatttctgaaaacgtttcttcaacttttttacttgaatcctagaactatctccttatcacatatttttttgtcgggcatggagttattatgctagttatttcctagggataagataattatatggaaattttacaaagaattaaaaaaaaacaccctaaaaattcaagaaaaaattgtgtcagaaaataagaaaaaagtgatgggacgtatgcaataaacgatgggaaactggtggcaatgggaaacggaatattttcacaaaaaaagacaatcaaacacggtctcctggagtgttcataattattagagcgcggtaatttttctaggtgccagaagcttcgagttcaatcaaaaaaaactaaatttcacgcatataaattaccgcattttttattgggagatttatttagttttcataactttaaaaagtaatatctgatttgaaatgaactcttttgaaaattcaaattgaattctatactgtgcgtctagactttgtgttttatcgtgatttttcgtttttgtggaaaatcgagtttggagaaacatctgtaaaattcgtttagaagagtgaaaagataaaaaattgaagcattgaaaataaacatttattgcaatcggactgtttggatttatcatttgtggccctaaagagggccgttgggttcggtggttgttgcatggaagcgggaggacaattgaaattatcctccgaatccgtacagggttcttccttgtctcttcagagcatagacaacgtccatggctgtgacggtcttcctcttggcgtgctcgcagtaagtgacggcgtctcggataacgttctcaaggaacaccttgagaactccacgagtttcttcgtagatcaatccagagatacgtttgactcctcctcttcttgctagacggcgaatggctggcttcgtgattccttggatgttgtcccgaaggactttacgatggcgcttggcacctccttttccaaggccttttcctccctttccacgtccggacattgttgagtgattggctgaagactcacgaatgatgatgaactgggaaaacagttct