Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T23D8.5_b   

sjj_T23D8.5_bSequenceAGAACTGTTTTCCCAGTTCATCA
PCR_productsjj_T23D8.5