Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D8.7   

sjj_T23D8.7RNAiJA:T23D8.7
PCR_productsjj_T23D8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D8.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Chunk_score Abs_score1023
Max_abs_score1023T23D8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99900269991192
Overlaps_transcriptT23D8.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D8.71167acaggtgaatgcctgagaaattacaattaaaacatttaaaaatttcagagagccattcaaattgataggaaagccacttcccagcactacaggacgattcttatcacttctcgccaatcattttcaaatcacgtgcaatggatcgattattcatcaatactatattcgattcgatccagatattccgtcgaaaaagctgaacagaacgattttgagaactctgcaagaacagaatcccggacttatcgagtgcccgttagttttcgatggaattcacactgtgtactcaacagagctgattaatgtcaaggaagtgaataattcagtcatcaatgttgcaggagttgttaatacaaaagaatcacctaatctattcaaactctatctaacacatgtcgacagcttcctcttggatactaaaatgtgagtttttacttggaaaaccttcttcattgtttttaattcaatctttttcagtatcacaggaaatcaggatcagaaccagaagttgcgaatgatgcatgcaattgatactgtcttccgtcaaacttctactggaaatttccatgccgtgcttcaatctttcttctcaattgcacaaaattctgcaatcgaaccctcgcatggccttggatggggaactgtcaatttaggagttggacgagaagtttgctacggtttttatcaaaatgttgttgagacattcgatacactcactatgaatctcgacgttgcaacaactacattctaccgccccgtggctctcgtggaattccttgctgaaattctggaagttccactggcaacagtcaccgacggacgttcgctgagcgatgttcaaaagaaaaagttcaaccgtgaagtggccggactcaaagttgaaaccagacactgtagttgtccacgaagatttcgtgtcgcccgttgcacttggaaaccaactgaaaatattagtttccatctctccgagactgccggcaatcaagattctaaacctctctcattggttgaatactataaaaggcgttataatatcgatctgacatataagcatcttccgtgtattgaagttggacgcactcgagaatgtattcttcctttggagctttgttacgtagtcagtggccaacgatgtatcaagaaactgaatgaacaacagattgcaaa