Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D8.9   

sjj_T23D8.9 RNAi JA:T23D8.9
Simmer:T23D8.9:Screen_A
Simmer:T23D8.9:Screen_B
PCR_productsjj_T23D8.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T23D8.9a Source_evidenceePCR944WS150 Sequence/Annotation Release
T23D8.9b Source_evidenceePCR397WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.9 Source_evidenceePCR944WS150 Sequence/Annotation Release
Chunk_score Abs_score818
Max_abs_score818T23D8.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99820409983132
Overlaps_transcript T23D8.9b Source_evidenceePCR545WS150 Sequence/Annotation Release
T23D8.9a Source_evidenceePCR944WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D8.91093gattttggcctgcaatcaatcgatacgatccgatcattacagcattcaattttataattaatcctgttggcggaggaggttgatcatgtggattattgttccatatgaagtaatctttcaatcgagtatccttgctaataataaatcgaaaaatgatgaaaattgctggatttatcattcccgggtgtacttgaggattaaagtactcggagagagtgccaacgagtttttcgaatttcaaatgttgagcgaattctgttctcaatttctcgtttttcactcccattatgatacagttgaaaatttgaaacacctgatttgcgcagtgtttcatgtgaggatctttttgccaatttaacgaaatcaaattgcaaatcaattctcgaaaatcttgtggaccattctctcgaggacaaaacatttgaacaacttgatgaatatatggtgaaataatgggtagaaatgtgaatcttcgaagaatatccaacagattataccagagttgagcctgaaaaaatatgatttgaaatctgtaatttgtgttgagacttacataatatgaaattggaagttgaactggttgaggtttcagaccatcgtaaattatgttaaggatttgttgtacgcagttctgaaaaaaattacagattttgtaaaaagaattccaacatttttggaaaactcaccggcatatttgcctgatcaacttgtgcaaatttatcttgtcgtatccaagttcgtattgtttttgccatatgaagtctttgcatgggatctggtgtattaaaccatagctgaaattgaactttatcaagattcattattgatttttcaattacaaaccctaattgcttgttcagccgcttgtgttatattcatttgcatcatttcaggattcacattttcacatgttgaaccatttgatgagtagcatcgctgagaatcgggaaattgatttgtcatggttgtattcacactgagcattgacattcgatcgtctccttgatgatatgacataactgatggagcaactggtggagcaggagattgagaatatggccatgcttgattgttgatccattgttctgtccga