Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23G11.3   

sjj_T23G11.3 RNAi JA:T23G11.3
Simmer:T23G11.3:Screen_A
Simmer:T23G11.3:Screen_B
PF:GL1_4H12
PCR_productsjj_T23G11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23G11.3 Source_evidenceePCR923WS150 Sequence/Annotation Release
Overlaps_Gene T23G11.3 Source_evidenceePCR923WS150 Sequence/Annotation Release
Chunk_score Abs_score782
Max_abs_score782T23G11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI76959617697155
Overlaps_transcriptT23G11.3 Source_evidenceePCR923WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23G11.31195tgacgctatcgacgaacaacagacacatcatgtccccgatttcgagcgcttacagtcaaacacctaattcgcttttgtcgccagccatgttcaatccaaagagcagaagtatcttttccccgactcttcctgcaactccaatgagttatggaaaatcatcgatggacaagagtatgaaacaatctcatgtctacttatttttctgtaatttcttcaggcctgttctctccaacagctacagaaccaatcgaggttgaggcaactgtcgagtacttggctgatctggttaaagagaagaaacatcttacgctctttcctcatatgttcagcaatgttgaacgtttgttggatgatggtacataaccgctctgtgttcctacaagtaattattttattttagaaatcggtcgtgtccgcgtggctttgttccaaactgagtttccgagagttgagcttcctgagcctgctggagacatgatttcgatcactgagaagatttatgttccaaagaacgaatacccagacgtaatttaacgaatttcaagttttcgaacaactaaaacatttcagtataacttcgtcggtagaattctcggcccacgtgggatgaccgccaagcagcttgagcaggacactggatgcaagattatggtccgaggaaagggatcaatgcgggacaagtcaaaggtttgatcttgttacaattttatctaaaacaaagtttagttgttgaaggaaagtgctcaccgtggaaaggccaattgggagcatctcgaagacgatctgcacgttcttgtgcaatgcgaagacactgagaatcgtgttcacatcaaattgcaagcagcactcgaacaggtcaagaagttgctcattccggctgtgagttatatgcttcgtaaaatctctacaataacctattttcagcccgagggaactgacgagctgaagagaaaacaacttatggaacttgcaatcatcaacggtacgtatcgtccaatgaagtcgccaaacccagctcgtgtgatgactgcagttcctctgctctctccaactccactacgtagttcaggtccagttttgatgtcgccaactcctggatcaggactcccgtcaacgacatttggaggatcgatcttggtagaacagttcttcagtttaagtttcatatttttaatttcagagccccactctcact