Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23G11.4   

sjj_T23G11.4RNAiJA:T23G11.4
PCR_productsjj_T23G11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23G11.4 Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene T23G11.4 Source_evidenceePCR733WS150 Sequence/Annotation Release
Chunk_score Abs_score691
Max_abs_score691T23G11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI76941957695172
Overlaps_transcriptT23G11.4 Source_evidenceePCR733WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23G11.4978tattgcatccaacaatctcacacagtttgattatttgaaaaactgttctgattcagaaaaatgttacatttacactttgaaaacttttttctaaaatttgaatgctatttaatttttaaactttaagcatcaacgaacacaatggccgatatcttcagaaaaccaaaatcaaaaattcaaaaaaggaaaattttagaagacgacgacgttgctgctgatggtatttaatttttaatctgataaaataattgtttttaaagcaaatgataacttaagagcataacatgcattaaaatttttaatgttctaaatttttttttccagaagagtcgtcaagagtttccgatattcgagatcttcaacgatcacgagaaaggaaaaatggtctcacagaattagaatgcgcagttggaatttcaaaagctgcagctctcgaggatggaattcaaatggctggtggcggaatggtgatgacaagtaaaaagaaggcagcaatggaagctgcaagcattgaacaaggactccgagaacaattcgagaaggaaacaatgctgagagatgaacatgaagaattaaggaaatatattgatgacggacttcaagaatatacagctgatacttctaaaattgaaaaacagaaacaaccttcttcatcagctgcagctaaattttcatcgctgaatgcagaagatcgtgatgtagagcttttgaaacaagctgctggaaaagtgaagggaaatcaaagcaaaaaggagacagaattgctttcagagcatatgctcgcaggaatcccagaagtggacctgggaattagcactcgtatcaccaatatcttggagactgaaaagaaaaaacgattccttcttcaaatatctgctgctgaagctgcaggtcttccaccaccaattgaagaatgtgaagaatcaaaaccaaaatatcgaagacgtttcaacaaccagcgtcgataaattgagatac