Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23G11.6   

sjj_T23G11.6RNAiJA:T23G11.6
PCR_productsjj_T23G11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T23G11.6 Source_evidenceePCR920WS150 Sequence/Annotation Release
T23G11.6b Source_evidenceePCR920WS150 Sequence/Annotation Release
Overlaps_Gene T23G11.6 Source_evidenceePCR920WS150 Sequence/Annotation Release
Chunk_score Abs_score822
Max_abs_score822T23G11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI76866867687814
Overlaps_transcript T23G11.6b Source_evidenceePCR920WS150 Sequence/Annotation Release
T23G11.6 Source_evidenceePCR920WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23G11.61129acgagaaggtctggctgaaattcagtctttcttatccattgccttgaaacgaacaatcataaagagcagagaagaacttacaattttcaattctgtggtagtctcttcaactgttgaagttgtagttgtcgatggagcagttgtcgtatcactcttttcatcgtatggctgaaatttctcaacctcaacttgaagtatttgttcgccacgaagggtataaggacgatcacagacggtttcatttgtgtttgcaacaaagaatgaatttccattttcttcggcctttttgacacgatcttctactccgaagacgacttaaaacaaggacttatgaaatttaaataaaccgagatacttacaattaaccaattctccgtcgcatcgatatggattcgaagaaacatccagtgactcaattgctggcagatttttaataagctgaaaaacttatgattggagcgaagtttcagtaatttttgaactgaacttacatttggtagggatttaagcttattcttctggagatttaatttcttgagtgaatccttttgattctcaaaagtgttctcaacaatgtttgaaatattgcattttgataagtccaattcttcaagttttggataatctttcaattgatctgcagaaatggaagtgaacccgcattcagctaatgacaatttttcgagcattccaagtcctgtcgaagggagctcggaaatcggattatttcgaagacttattgttttcagtttatcagtcagtggcttgaatacatctgttggaatagtcttgatctcgttccatcccaagtctagttcttctaagctggaaagaccaaagaaaacgtcaggctccaattttctgaaataaaataaatagttgcataattgtaagtatgtactcacgaaataaagtttcctgccaaagaaagtcttgtcaaactctccaatccatcaaaagcataagctgtgatattttcaatgaggttgactcggagatcaagctcttttaattttttgagtgtggcaaactgccctggctctaatgttggaattgagcatccggatagtttgagtacttcaatttgtggaatttctttgaacaatgtctcaggtggttggaagattcc