Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23H2.3   

sjj_T23H2.3RNAiJA:T23H2.3
PCR_productsjj_T23H2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23H2.3 Source_evidenceePCR927WS150 Sequence/Annotation Release
Overlaps_Gene T23H2.3 Source_evidenceePCR927WS150 Sequence/Annotation Release
Chunk_score Abs_score888
Max_abs_score888T23H2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64426426443598
Overlaps_transcriptT23H2.3 Source_evidenceePCR927WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23H2.3957tctccaaaatttcacgaacaacttccagcgttttggccatcttgcagctaatgaaatcgggctcaaagattcgcgtgggtggttgttttggctcctccttatttgtatcgacgccttcctcatcattatcactatcggcaatcgtcaaatccgccattgtcttctccataagattctccaactctttcatatcagcatcctcgtcgtctcctccgttaatcttgaatgcgtccaagtccattccgcttttggtgatatgaaagtgaacacacgcttgacgaagacgcatcagcaacaacaaaatgcatgacatattctggaaattcgagtttcccgccaagttccgtggcccgacgttgtacgggttcgcgaattcatcatcatttcctcgttgtctgcgtctacgaatctgaccgtacttttgaatatcatcagtattagtgacgatttgcttaacaagcttttgtgccgcctccatcataattgcatagccattggcttcatctccaaccatctccaactcatggatctcgattttcttttctttcaagtttacaattttcttattggtcagagcgcactgctgatccttagttcttctgagcatcaaatttttcgtcagcaaattcacacgatccgccattccagtcttcattggcataattgattcggcccagaacttccgatcgccgaacaacgggatacgcaaaaacctcacgagactgtacaaatcccataggttattgtgaatcggagtacccgagagacaccaacgcgagaatgatgagagccggcacactgcttttgaacattgggagagacgatttttgatggcatgagcctcgtcgagaatcacacgggaccaagcgacacgagcaagaggggagtcgtttttgccagcagggcgacggggattttcttcgttctctggaaaaaattaatgaaatcgcggaaaat