Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T24C4.7   

sjj_T24C4.7RNAiJA:T24C4.7
PCR_productsjj_T24C4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST24C4.7 Source_evidenceePCR810WS150 Sequence/Annotation Release
Overlaps_Gene T24C4.7 Source_evidenceePCR810WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789T24C4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII893191894135
Overlaps_transcriptT24C4.7 Source_evidenceePCR810WS150 Sequence/Annotation Release
WB_DNA_textsjj_T24C4.7945ctttttgcttcgccaaagacgaaatatgaaagatcagaaaatgttcggttttttatgatttttttgttgagaaatctgaatttttaatttacaaaatgttccgttcttcgaaatataaattttcgaattacttacaaagacttttcttccaggttcaaaactagtgttcaatcgattctcaacaccttcctcttcatttctcaattctgaatgataagaaatatacttgtcgtgaatgatttcttgattatctccattatgatataaattaggagcttttctattgaacattcgttcgaatggcgtctccattcgatcaggaatcggtttctgattatattccattacgagaaattgcaattgttctacccatcggtttcgtgttccaagctcattttgagctagttccagaacccatcgttctagacaattatacggaagcggttcattccaaacttctcgaatttccacagcatacacactttccaatgattttattgtatcccggatgtatgtcggcgagaatgatgttgaaaatccctccggaacaccgtattcattaaaaatcgagttcaaaattcgtccgatcgctgttcttgtgcactcgaaaagtggtttcgcccacaaaaatcgtgttttcagacaagtgacgatgagaatgttgtcgtatattttgtttccataaattgaagttggcatctcatgaacatcgatttgaacatattgcattggatgattagcccaacatgctggtttaatggggaacactatatccattggtctagcattatctgcattgctattctgagattctgtgtcaggagcatgaccgatgtgatagagctgcatgaacgtatgtacttcaccgctggaggattcgacacggtatgagatgactgaggggcacgctgatccttctttcaacattctttcacgtgggagtcg