Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T24F1.6_f   

sjj_T24F1.6_fSequenceCAACCGTACCCCTCTCAAAA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_T24F1.6