Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T25D1.2   

sjj_T25D1.2RNAiJA:T25D1.2
PCR_productsjj_T25D1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST25D1.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
Overlaps_Gene T25D1.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score685
Max_abs_score685T25D1.2
Specificity_index0.586
Rel_score1
Map_statusUnique_ePCRX1651669216517808
C36C9.4 Chunk_score Abs_score483
Specificity_index0.414
Rel_score0.705
Overlaps_transcriptT25D1.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
WB_DNA_textsjj_T25D1.21117tctcgaggcaagaagttggttatttggaaacttttgaaaatgcaaaaattaccaattcagcaaatattgtggtggtcctgttgcctcctttgtccgggttggagcgtttacccaaattgtagagctcgtcgaaacttacatggatgacattctggagctacgggaacagctgaaaaatgatcgaaatcttgaacataacctggctagtccatttttctctagtttccgagaaactgaatctccgaatcgtcttcgtctgtccttggtcgtatcgattgacggagtgcgcatttctggaaataagaagttggtttcgcatttagaaaaaatattcatttgagtattttaatttctaggaagctttggccagtcagttacatcatcgttgatctgccaactggactgatgcagaagtctacaaacattgtactaggtggaattgtagagtgtagtgaaaatccaactacaactctgtggaatgcacttattccgttcatactatctgatgtagaatcacattctggaaaagtcagaaatacatcattcacttgccacattcgaacatgctcagccgatcagcccgtaagtagtatctttctttgatgacaactgtgttcgtagtgtcaattactacttatattcgaaattaaaaacggtgatttcaggcaaagcgggctttctttggtttcatggcacatcagtcggcagagtcatgttttttttgtatgtcgccaggaactttgtacaagtttggtgatcgaaaacgccgtgaggaacgcccaggatatgaaacaatcgtagattcagagcagggtgtgcatggttttggtccaattccagcaaaaattgttccccacgttctcccatacaatacaccaattgatattttgcacaacttgggagagggaatctatacattcattagaaaaggtgatatctgaatcaggggtgcgcggcaaattgatttgtcgacaaattcggcaattcggcaatttgccgatttgccagatattagaattttggcaatttgcccatttgccgatttgccggaaatttcaattccggcaatttgctcatttgccggacaaaatggtttgccgtctacccctgatctgaa