Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T25E12.4   

sjj_T25E12.4 RNAi (10)
PCR_productsjj_T25E12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST25E12.4a Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene T25E12.4 Source_evidenceePCR792WS150 Sequence/Annotation Release
Chunk_score Abs_score748
Max_abs_score748T25E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1678861716789703
Overlaps_transcriptT25E12.4a Source_evidenceePCR792WS150 Sequence/Annotation Release
WB_DNA_textsjj_T25E12.41087actttttacgtatgccgtcgttaaattgcgacacaattaggtgaagattgatcgggggagacggattctgaaatcaacatgttttcctgttttttgaacacgcgccactgctgccggaagaaaatttggcgaattttagttgcagtagaactgttttttaacaaataaataatgggatttgcacaattttttttggcgaattcgatgatgacgtacaactatcttgttttttttcaggagaaactgggcaccttggcgcgaaaatccaaacggaacacgaattctcacaactttatcaaatattcgctgaagaagtcctcggatccggacagtttggtactgtttacggaggaatccaccgacgaaatggtcaacacgtcgccgtgaagctcatcgataagctgaaattcccgccgaacaaggaggatctgttgcgggctgaagtgcagatcttggagaaggtcgaccatcctggggtggttcacttcatgcagatgcttgagacgactgatcggatctttgttgtgatggagaagctgaagggtgacatgttggagatgatcttgtccagtgagaaaggaaggctttcggaacggactacgcagttcctggtggctcagatccttgaagctctccgttaccttcatcatttgaatattgtgcattgtgacttgaaaccggagaatatccttctcaactcgaactcggacttcccacaagtcaagctttgcgatttcggattcgctcgaatcattggagagaagagcttcaggcggagtgtcgtcggaacgcctgcctacctggcgcctgaagttctacggaacaagggattcaatcgatcgctcgacatgtggagtgtcggtgtgattgtctacgtctcactgtcgggaacgttcccgttcaacgaggacgaggatatcaacgatcagattcagaacgccgaattcatgtacccgccgacaccgtggaaggagatctctgagaatggtagggcgaatacttttgttagaaaagaatctgtgagatttattgaattcttttgcagctatcgaattcatcaacggactgctccaagttaagatgagca