Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T25G12.9_b   

sjj_T25G12.9_bSequenceATCAATCGCTCTCGTAAATGTGT
In_sequence (6)
PCR_product (8)