Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26A5.3   

sjj_T26A5.3RNAiSimmer:T26A5.3
PCR_productsjj_T26A5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.3 Source_evidenceePCR936WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.3 Source_evidenceePCR936WS150 Sequence/Annotation Release
Chunk_score Abs_score831
Max_abs_score831T26A5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64655246466664
Overlaps_transcriptT26A5.3 Source_evidenceePCR936WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26A5.31141ctcaactttggaccacagcaccctgcggctcacggagttcttcgtcttgttctcaagctggaaggagaagtcatcattaaagctattccacatattggtctgctacatcgcgctacagaaaagctcattgagcacaagacctacacacaggttgagtcgaaacaaatttcaattcgaattcgaataaaattgtaggcactcccgtatttcgatcgccttgactacgtatccatgatgtgcaacgaacaagctttctctctggcaattgaaaaattgttggggattgacgttccaccaagagcgaagtatatcagaagtgagctatatgaatcgagtatcgcaatttaacattttaaaacatattttcagttcttttcggcgaactcactcgaattcaaaatcatattatgggaatcaccacacacgccctcgacgttggagctatgaccccattcttctggatgttcgaagaacgcgaaaaattattcgaattctcagaacgagtttcaggtgcaagaatgcacgcaaactatgttcgtccaggcggagtcgcatgggatcttcctgttggattaatggatgatatttatgattgggctgtgaagtttcccgctcgtatcgatgaactggaggatatgcttacagaaaatcgaatctggaaagctagaacagttgatattggtaagtgtgacatcattgagagcataatgaaatccaatatcttctaattttcattattttaggccttgtctccgcatccgatgctcttaattggggattcagtggtgtgatggttcgtggaagtggaattaagcaagatgttcgaaaaaccgaaccatatgatgcctatgccgatatggaattcgatgtaccaatcggaacaaagggagattgctatgatcggtaaaaaatagagaggaaacattcaatcattatctcatttttcagttatttgtgtcgcgtagaagaaatgagacaatcgttgaacattgttcatcaatgcctcaacaaaatgccaactggagaaattaaatccgacgatcacaaagtggtgccaccgaaacgagctgaaatgaaagagaacatggaatcgcttattcatcactttaaatttttcactgaaggattccaagtaccgcct