Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26A5.7   

sjj_T26A5.7 RNAi JA:T26A5.7
Simmer:T26A5.7
PF:GL1_4G11
PCR_productsjj_T26A5.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.7a Source_evidenceePCR603WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.7 Source_evidenceePCR622WS150 Sequence/Annotation Release
Chunk_score Abs_score418
Max_abs_score418T26A5.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64514166452609
Overlaps_transcript T26A5.7b.2 Source_evidenceePCR619WS150 Sequence/Annotation Release
T26A5.7a Source_evidenceePCR619WS150 Sequence/Annotation Release
T26A5.7b.1 Source_evidenceePCR622WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26A5.71194gatttccaccacctggaatgtttagttttggaattgttatttacatttttttaatttatcaaagactttcttaataaatttcaaattttgaaatgctcactttcgttttgagattcggccttaacacggaatgattgatgagtcgtcctttccatggagattcttttgtcgcatcgatacaccattttttattgttgtgctcaaaaaagtacatgtaggatccgatttcctcatcattcgaatattgttcttctatcacttttgcttccgagtactccatcataacacctagaatactttttaaaaacaatattacaacaattatctgtgttatctacatacctctgtattcgacaacaaagtctcctttttcaaagttaactttcgttcgaattcctcgccccttcacaacatctttgtacacttcaagaagtcgttcattagtccccttgagtacggtatcgcgaagagcatgtttagcttcatcgctaatttgcttgctcgtcttccgattacttcgccgcacttggaagaattctgtgattttatggtttgagacatctttcaccgacactccttttctgaaagaaaaactatttggaaattgaagttttcagcttggacaatttctgtgaatatgttgtgaattcaattagaaatattgaagtttttaaacgttctattacaatccctcttgtcactaatcaatcatacctgctccttgtgtttttcgacggtgtcattcttcctgaagatgaagagtgtgaagccaaagacgatggattttcggagttctcaatatcactagatggtgacgctgctgcggcacgatcctttcgcattctactcgttgccagcttcttcgcggcaactttcatccttcgagtgacaccgctgaaaaaataataaattttgtagggtgaggagaatagtaaaaatagagaaatttataaagaagcaaaagaggtgtcatagaaataatagaaatattcgcccacaatttattttttttgttttgaaatggttgggtaaaaatattataatgtgttgtttcaaaaacccagatattcaatatgatttcatcggtcctgaatactgtaattgaaaatggaaaagccatcttggatgtacctgaaaaagtagttgggaagagggtaacagaggaaattgaagcgggcagagagatgcgtaaag